RAB40A

RAB40A siRNA

20-abx930679
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB40A antibody

70R-5855 50 ug
EUR 467
Description: Rabbit polyclonal RAB40A antibody raised against the middle region of RAB40A

RAB40A Antibody

46187-100ul 100ul
EUR 252

RAB40A Antibody

46187-50ul 50ul
EUR 187

RAB40A Antibody

DF9830 200ul
EUR 304
Description: RAB40A Antibody detects endogenous levels of total RAB40A.

anti-RAB40A

YF-PA22329 50 ul
EUR 363
Description: Mouse polyclonal to RAB40A

anti-RAB40A

YF-PA22330 50 ug
EUR 363
Description: Mouse polyclonal to RAB40A

RAB40A Conjugated Antibody

C46187 100ul
EUR 397

RAB40A/L Antibody

ABD9831 100 ug
EUR 438

RAB40A / L Antibody

20-abx218200
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB40A Rabbit pAb

A13236-100ul 100 ul
EUR 308

RAB40A Rabbit pAb

A13236-200ul 200 ul
EUR 459

RAB40A Rabbit pAb

A13236-20ul 20 ul
EUR 183

RAB40A Rabbit pAb

A13236-50ul 50 ul
EUR 223

RAB40A Blocking Peptide

33R-8107 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB40A antibody, catalog no. 70R-5855

RAB40A/L Antibody

46188-100ul 100ul
EUR 252

RAB40A/L Antibody

46188-50ul 50ul
EUR 187

RAB40A Blocking Peptide

DF9830-BP 1mg
EUR 195

RAB40A/L Antibody

DF9831 200ul
EUR 304
Description: RAB40A/L Antibody detects endogenous levels of total RAB40A/L.

RAB40A cloning plasmid

CSB-CL848839HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 834
  • Sequence: atgagcgccccgggcagccccgaccaggcctatgacttcctgctcaagttcctgctggtgggcgacagggacgtaggcaagagtgagatcctggagagcctgcaggatggtgcagctgagtccccgtacagccatctcggggggatcgactacaagacgaccaccatcctgctgga
  • Show more
Description: A cloning plasmid for the RAB40A gene.

Anti-RAB40A antibody

STJ115202 100 µl
EUR 277
Description: This gene encodes a member of the Rab40 subfamily of Rab small GTP-binding proteins that contains a C-terminal suppressors of cytokine signaling box.

RAB40A/L Conjugated Antibody

C46188 100ul
EUR 397

Human RAB40A shRNA Plasmid

20-abx965353
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB40A/L Blocking Peptide

DF9831-BP 1mg
EUR 195

RAB40A Recombinant Protein (Human)

RP042676 100 ug Ask for price

RAB40A ORF Vector (Human) (pORF)

ORF014226 1.0 ug DNA
EUR 354

RAB40A sgRNA CRISPR Lentivector set (Human)

K1774401 3 x 1.0 ug
EUR 339

Ras-Related Protein Rab-40A (RAB40A) Antibody

abx029863-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-40A (RAB40A) Antibody

abx029863-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-40A (RAB40A) Antibody

20-abx218128
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB40A sgRNA CRISPR Lentivector (Human) (Target 1)

K1774402 1.0 ug DNA
EUR 154

RAB40A sgRNA CRISPR Lentivector (Human) (Target 2)

K1774403 1.0 ug DNA
EUR 154

RAB40A sgRNA CRISPR Lentivector (Human) (Target 3)

K1774404 1.0 ug DNA
EUR 154

RAB40A Protein Vector (Human) (pPB-C-His)

PV056901 500 ng
EUR 481

RAB40A Protein Vector (Human) (pPB-N-His)

PV056902 500 ng
EUR 481

RAB40A Protein Vector (Human) (pPM-C-HA)

PV056903 500 ng
EUR 481

RAB40A Protein Vector (Human) (pPM-C-His)

PV056904 500 ng
EUR 481

RAB40A 3'UTR Luciferase Stable Cell Line

TU019395 1.0 ml
EUR 1394

RAB40A 3'UTR GFP Stable Cell Line

TU069395 1.0 ml
EUR 1394

Human Ras- related protein Rab- 40A, RAB40A ELISA KIT

ELI-30097h 96 Tests
EUR 824

RAB40A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1774405 3 x 1.0 ug
EUR 376

RAB40A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1774406 1.0 ug DNA
EUR 167

RAB40A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1774407 1.0 ug DNA
EUR 167

RAB40A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1774408 1.0 ug DNA
EUR 167