RAB40A

RAB40A antibody
70R-5855 50 ug
EUR 467.00
Description: Rabbit polyclonal RAB40A antibody raised against the middle region of RAB40A

RAB40A Antibody
ABD9830 100 ug
EUR 438.00

RAB40A Antibody
46187-100ul 100ul
EUR 252.00

RAB40A Antibody
46187-50ul 50ul
EUR 187.00

RAB40A Antibody
DF9830 200ul
EUR 304.00
Description: RAB40A Antibody detects endogenous levels of total RAB40A.

anti-RAB40A
YF-PA22329 50 ul
EUR 363.00
Description: Mouse polyclonal to RAB40A

anti-RAB40A
YF-PA22330 50 ug
EUR 363.00
Description: Mouse polyclonal to RAB40A

RAB40A/L Antibody
ABD9831 100 ug
EUR 438.00

RAB40A Rabbit pAb
A13236-100ul 100 ul
EUR 308.00

RAB40A Rabbit pAb
A13236-200ul 200 ul
EUR 459.00

RAB40A Rabbit pAb
A13236-20ul 20 ul
EUR 183.00

RAB40A Rabbit pAb
A13236-50ul 50 ul
EUR 223.00

RAB40A/L Antibody
46188-100ul 100ul
EUR 252.00

RAB40A/L Antibody
46188-50ul 50ul
EUR 187.00

RAB40A Blocking Peptide
DF9830-BP 1mg
EUR 195.00

RAB40A/L Antibody
DF9831 200ul
EUR 304.00
Description: RAB40A/L Antibody detects endogenous levels of total RAB40A/L.

RAB40A Conjugated Antibody
C46187 100ul
EUR 397.00

RAB40A Blocking Peptide
33R-8107 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB40A antibody, catalog no. 70R-5855

RAB40A cloning plasmid
CSB-CL848839HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 834
  • Sequence: atgagcgccccgggcagccccgaccaggcctatgacttcctgctcaagttcctgctggtgggcgacagggacgtaggcaagagtgagatcctggagagcctgcaggatggtgcagctgagtccccgtacagccatctcggggggatcgactacaagacgaccaccatcctgctgga
  • Show more
Description: A cloning plasmid for the RAB40A gene.

RAB40A / L Antibody
20-abx218200
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-RAB40A antibody
STJ115202 100 µl
EUR 277.00
Description: This gene encodes a member of the Rab40 subfamily of Rab small GTP-binding proteins that contains a C-terminal suppressors of cytokine signaling box.

Human RAB40A shRNA Plasmid
20-abx965353
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB40A/L Blocking Peptide
DF9831-BP 1mg
EUR 195.00

RAB40A/L Conjugated Antibody
C46188 100ul
EUR 397.00

RAB40A Recombinant Protein (Human)
RP042676 100 ug Ask for price

RAB40A ORF Vector (Human) (pORF)
ORF014226 1.0 ug DNA
EUR 354.00

RAB40A sgRNA CRISPR Lentivector set (Human)
K1774401 3 x 1.0 ug
EUR 339.00

Ras-Related Protein Rab-40A (RAB40A) Antibody
abx029863-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-40A (RAB40A) Antibody
abx029863-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-40A (RAB40A) Antibody
20-abx218128
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB40A Protein Vector (Human) (pPB-C-His)
PV056901 500 ng
EUR 481.00

RAB40A Protein Vector (Human) (pPB-N-His)
PV056902 500 ng
EUR 481.00

RAB40A Protein Vector (Human) (pPM-C-HA)
PV056903 500 ng
EUR 481.00

RAB40A Protein Vector (Human) (pPM-C-His)
PV056904 500 ng
EUR 481.00

RAB40A sgRNA CRISPR Lentivector (Human) (Target 1)
K1774402 1.0 ug DNA
EUR 154.00

RAB40A sgRNA CRISPR Lentivector (Human) (Target 2)
K1774403 1.0 ug DNA
EUR 154.00

RAB40A sgRNA CRISPR Lentivector (Human) (Target 3)
K1774404 1.0 ug DNA
EUR 154.00

RAB40A 3'UTR Luciferase Stable Cell Line
TU019395 1.0 ml
EUR 1394.00

RAB40A 3'UTR GFP Stable Cell Line
TU069395 1.0 ml
EUR 1394.00

Human Ras- related protein Rab- 40A, RAB40A ELISA KIT
ELI-30097h 96 Tests
EUR 824.00

RAB40A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1774405 3 x 1.0 ug
EUR 376.00

RAB40A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1774406 1.0 ug DNA
EUR 167.00

RAB40A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1774407 1.0 ug DNA
EUR 167.00

RAB40A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1774408 1.0 ug DNA
EUR 167.00