Gentaur Cz

Lékařská biotechnologická výzkumná laboratoř

RAE1

RAE1 antibody
22381-100ul 100ul
EUR 390

RAE1 antibody
70R-12978 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RAE1 antibody

RAE1 antibody
39124-100ul 100ul
EUR 252

RAE1 Antibody
DF8442 200ul
EUR 304
Description: RAE1 Antibody detects endogenous levels of total RAE1.

RAE1 antibody
70R-4675 50 ug
EUR 467
Description: Rabbit polyclonal RAE1 antibody

RAE1 antibody
70R-4676 50 ug
EUR 467
Description: Rabbit polyclonal RAE1 antibody

RAE1 Antibody
1-CSB-PA019276ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAE1. Recognizes RAE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAE1 siRNA
20-abx904450
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAE1 siRNA
20-abx930796
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAE1 siRNA
20-abx930797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAE1 Antibody
ABD8442 100 ug
EUR 438

RAE1 Blocking Peptide
33R-2670 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAE1 antibody, catalog no. 70R-4675

RAE1 Blocking Peptide
33R-8290 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAE1 antibody, catalog no. 70R-4676

RAE1 Blocking Peptide
DF8442-BP 1mg
EUR 195

RAE1 Conjugated Antibody
C39124 100ul
EUR 397

RAE1 cloning plasmid
CSB-CL019276HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1107
  • Sequence: ATGAGCCTGTTTGGAACAACCTCAGGTTTTGGAACCAGTGGGACCAGCATGTTTGGCAGTGCAACTACAGACAATCACAATCCCATGAAGGATATTGAAGTAACATCATCTCCTGATGATAGCATTGGTTGTCTGTCTTTTAGCCCACCAACCTTGCCGGGGAACTTTCTTATTG
  • Show more
Description: A cloning plasmid for the RAE1 gene.

RAE1 Rabbit pAb
A6713-100ul 100 ul
EUR 308

RAE1 Rabbit pAb
A6713-200ul 200 ul
EUR 459

RAE1 Rabbit pAb
A6713-20ul 20 ul
EUR 183

RAE1 Rabbit pAb
A6713-50ul 50 ul
EUR 223

anti- RAE1 antibody
FNab07086 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: RAE1 RNA export 1 homolog (S. pombe)
  • Uniprot ID: P78406
  • Gene ID: 8480
  • Research Area: Metabolism
Description: Antibody raised against RAE1

Anti-RAE1 antibody
PAab07086 100 ug
EUR 412

Anti-RAE1 antibody
STJ28796 100 µl
EUR 277
Description: Mutations in the Schizosaccharomyces pombe Rae1 and Saccharomyces cerevisiae Gle2 genes have been shown to result in accumulation of poly(A)-containing mRNA in the nucleus, suggesting that the encoded proteins are involved in RNA export. The protein encoded by this gene is a homolog of yeast Rae1. It contains four WD40 motifs, and has been shown to localize to distinct foci in the nucleoplasm, to the nuclear rim, and to meshwork-like structures throughout the cytoplasm. This gene is thought to be involved in nucleocytoplasmic transport, and in directly or indirectly attaching cytoplasmic mRNPs to the cytoskeleton. Alternatively spliced transcript variants encoding the same protein have been found for this gene.

Anti-RAE1 antibody
STJ70738 100 µg
EUR 359

Polyclonal RAE1 Antibody (Center)
APR04909G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAE1 (Center). This antibody is tested and proven to work in the following applications:

RAE1 ELISA KIT|Human
EF002293 96 Tests
EUR 689

Rat RAE1 shRNA Plasmid
20-abx990353
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAE1 shRNA Plasmid
20-abx975736
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal RAE1 Antibody (Center)
APR06961G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAE1 (Center). This antibody is tested and proven to work in the following applications:

Human RAE1 shRNA Plasmid
20-abx955559
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAE1 Recombinant Protein (Human)
RP042709 100 ug Ask for price

RAE1 Recombinant Protein (Mouse)
RP166550 100 ug Ask for price

RAE1 Recombinant Protein (Rat)
RP223505 100 ug Ask for price

Human mRNA export factor (RAE1)
1-CSB-EP019276HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 68 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human mRNA export factor(RAE1) expressed in E.coli

Polyclonal RAE1 Antibody (N-Term)
APR04887G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAE1 (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-RAE1 Antibody
APG00265G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RAE1 . This antibody is tested and proven to work in the following applications:

Rae1 ORF Vector (Rat) (pORF)
ORF074503 1.0 ug DNA
EUR 506

RAE1 ORF Vector (Human) (pORF)
ORF014237 1.0 ug DNA
EUR 354

Rae1 ORF Vector (Mouse) (pORF)
ORF055518 1.0 ug DNA
EUR 506

Polyclonal RAE1 antibody - C-terminal region
APR00780G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAE1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal RAE1 antibody - C-terminal region
APR00781G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAE1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Ribonucleic Acid Export 1 (RAE1) Antibody
20-abx005150
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Polyclonal MRNP41 / RAE1 Antibody (C-Terminus)
APG01100G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MRNP41 / RAE1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Ribonucleic Acid Export 1 (RAE1) Antibody
abx237086-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ribonucleic Acid Export 1 (RAE1) Antibody
20-abx322391
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribonucleic Acid Export 1 (RAE1) Antibody
abx433213-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Rae1 sgRNA CRISPR Lentivector set (Rat)
K7169401 3 x 1.0 ug
EUR 339

RAE1 sgRNA CRISPR Lentivector set (Human)
K1780301 3 x 1.0 ug
EUR 339

Rae1 sgRNA CRISPR Lentivector set (Mouse)
K3793301 3 x 1.0 ug
EUR 339

Rat mRNA export factor(RAE1) ELISA kit
E02M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat mRNA export factor(RAE1) ELISA kit
E02M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat mRNA export factor(RAE1) ELISA kit
E02M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human mRNA export factor(RAE1) ELISA kit
E01M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human mRNA export factor(RAE1) ELISA kit
E01M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human mRNA export factor(RAE1) ELISA kit
E01M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit mRNA export factor(RAE1) ELISA kit
E04M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit mRNA export factor(RAE1) ELISA kit
E04M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit mRNA export factor(RAE1) ELISA kit
E04M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse mRNA export factor(RAE1) ELISA kit
E03M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse mRNA export factor(RAE1) ELISA kit
E03M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse mRNA export factor(RAE1) ELISA kit
E03M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat mRNA export factor(RAE1) ELISA kit
E06M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat mRNA export factor(RAE1) ELISA kit
E06M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat mRNA export factor(RAE1) ELISA kit
E06M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog mRNA export factor(RAE1) ELISA kit
E08M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog mRNA export factor(RAE1) ELISA kit
E08M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog mRNA export factor(RAE1) ELISA kit
E08M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig mRNA export factor(RAE1) ELISA kit
E07M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig mRNA export factor(RAE1) ELISA kit
E07M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig mRNA export factor(RAE1) ELISA kit
E07M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey mRNA export factor(RAE1) ELISA kit
E09M0433-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey mRNA export factor(RAE1) ELISA kit
E09M0433-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey mRNA export factor(RAE1) ELISA kit
E09M0433-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey mRNA export factor(RAE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse mRNA export factor, Rae1 ELISA KIT
ELI-13997m 96 Tests
EUR 865

Porcine mRNA export factor, RAE1 ELISA KIT
ELI-19560p 96 Tests
EUR 928

Bovine mRNA export factor, RAE1 ELISA KIT
ELI-35553b 96 Tests
EUR 928

Human mRNA export factor, RAE1 ELISA KIT
ELI-36031h 96 Tests
EUR 824

Rae1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7169402 1.0 ug DNA
EUR 154

Rae1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7169403 1.0 ug DNA
EUR 154

Rae1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7169404 1.0 ug DNA
EUR 154

RAE1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1780302 1.0 ug DNA
EUR 154

RAE1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1780303 1.0 ug DNA
EUR 154

RAE1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1780304 1.0 ug DNA
EUR 154

Rae1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3793302 1.0 ug DNA
EUR 154

Rae1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3793303 1.0 ug DNA
EUR 154