RPS8 antibody
70R-20019 50 ul
EUR 435
Description: Rabbit polyclonal RPS8 antibody
RPS8 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS8. Recognizes RPS8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
RPS8 Antibody
DF3689 200ul
EUR 304
Description: RPS8 Antibody detects endogenous levels of total RPS8.
RPS8 antibody
70R-50355 100 ul
EUR 244
Description: Purified Polyclonal RPS8 antibody
RPS8 antibody
70R-33931 100 ug
EUR 327
Description: Rabbit polyclonal RPS8 antibody
RPS8 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPS8. Recognizes RPS8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
RPS8 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS8. Recognizes RPS8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RPS8 Antibody
ABD13244 100 ug
EUR 438
RPS8 Antibody
ABD3689 100 ug
EUR 438
RPS8 Blocking Peptide
DF3689-BP 1mg
EUR 195
RPS8 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RPS8 cloning plasmid
CSB-CL020478HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 627
  • Sequence: atgggcatctctcgggacaactggcacaagcgccgcaaaaccgggggcaagagaaagccctaccacaagaagcggaagtatgagttggggcgcccagctgccaacaccaagattggcccccgccgcatccacacagtccgtgtgcggggaggtaacaagaaataccgtgccctgag
  • Show more
Description: A cloning plasmid for the RPS8 gene.
RPS8 Polyclonal Antibody
A63358 100 µg
EUR 570.55
Description: Ask the seller for details
RPS8 Rabbit pAb
A18377-100ul 100 ul
EUR 308
RPS8 Rabbit pAb
A18377-200ul 200 ul
EUR 459
RPS8 Rabbit pAb
A18377-20ul 20 ul
EUR 183
RPS8 Rabbit pAb
A18377-50ul 50 ul
EUR 223
anti- RPS8 antibody
FNab07485 100µg
EUR 548.75
  • Immunogen: ribosomal protein S8
  • Uniprot ID: P62241
  • Gene ID: 6202
  • Research Area: Metabolism
Description: Antibody raised against RPS8
Anti-RPS8 antibody
PAab07485 100 ug
EUR 386
pOTB7-RPS8 Plasmid
PVTB00144 2 ug
EUR 356
Anti-RPS8 antibody
STJ11100330 100 µl
EUR 277
Anti-RPS8 (4D11)
YF-MA15267 100 ug
EUR 363
Description: Mouse monoclonal to RPS8
EF002640 96 Tests
EUR 689
Mouse RPS8 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RPS8 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS8 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS8. Recognizes RPS8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RPS8 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS8. Recognizes RPS8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RPS8 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS8. Recognizes RPS8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human RPS8 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RPS8 Recombinant Protein (Human)
RP027232 100 ug Ask for price
RPS8 Recombinant Protein (Mouse)
RP169310 100 ug Ask for price
RPS8 Recombinant Protein (Rat)
RP226898 100 ug Ask for price
Ribosomal Protein S8 (RPS8) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S8 (RPS8) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ribosomal Protein S8 (RPS8) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Ribosomal Protein S8 (RPS8) Antibody
abx122328-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ribosomal Protein S8 (RPS8) Antibody
abx237485-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ribosomal Protein S8 (RPS8) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S8 (RPS8) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RPS8 Polyclonal Antibody, HRP Conjugated
A63359 100 µg
EUR 570.55
Description: The best epigenetics products
RPS8 Polyclonal Antibody, FITC Conjugated
A63360 100 µg
EUR 570.55
Description: kits suitable for this type of research
RPS8 Polyclonal Antibody, Biotin Conjugated
A63361 100 µg
EUR 570.55
Description: fast delivery possible
Rps8 ORF Vector (Rat) (pORF)
ORF075634 1.0 ug DNA
EUR 506
RPS8 ORF Vector (Human) (pORF)
ORF009078 1.0 ug DNA
EUR 95
Rps8 ORF Vector (Mouse) (pORF)
ORF056438 1.0 ug DNA
EUR 506
Ribosomal Protein S8 (RPS8) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S8 (RPS8) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ribosomal Protein S8 (RPS8) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Rps8 sgRNA CRISPR Lentivector set (Rat)
K7098401 3 x 1.0 ug
EUR 339
Rps8 sgRNA CRISPR Lentivector set (Mouse)
K4392001 3 x 1.0 ug
EUR 339
RPS8 sgRNA CRISPR Lentivector set (Human)
K2018901 3 x 1.0 ug
EUR 339
Human Ribosomal Protein S8 (RPS8) ELISA Kit
abx382963-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rps8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7098402 1.0 ug DNA
EUR 154
Rps8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7098403 1.0 ug DNA
EUR 154
Rps8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7098404 1.0 ug DNA
EUR 154
Rps8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4392002 1.0 ug DNA
EUR 154
Rps8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4392003 1.0 ug DNA
EUR 154
Rps8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4392004 1.0 ug DNA
EUR 154
RPS8 sgRNA CRISPR Lentivector (Human) (Target 1)
K2018902 1.0 ug DNA
EUR 154
RPS8 sgRNA CRISPR Lentivector (Human) (Target 2)
K2018903 1.0 ug DNA
EUR 154
RPS8 sgRNA CRISPR Lentivector (Human) (Target 3)
K2018904 1.0 ug DNA
EUR 154
RPS8 Protein Vector (Rat) (pPB-C-His)
PV302534 500 ng
EUR 603
RPS8 Protein Vector (Rat) (pPB-N-His)
PV302535 500 ng
EUR 603
RPS8 Protein Vector (Rat) (pPM-C-HA)
PV302536 500 ng
EUR 603
RPS8 Protein Vector (Rat) (pPM-C-His)
PV302537 500 ng
EUR 603
RPS8 Protein Vector (Mouse) (pPB-C-His)
PV225750 500 ng
EUR 603
RPS8 Protein Vector (Mouse) (pPB-N-His)
PV225751 500 ng
EUR 603
RPS8 Protein Vector (Mouse) (pPM-C-HA)
PV225752 500 ng
EUR 603
RPS8 Protein Vector (Mouse) (pPM-C-His)
PV225753 500 ng
EUR 603
RPS8 Protein Vector (Human) (pPB-C-His)
PV036309 500 ng
EUR 329
RPS8 Protein Vector (Human) (pPB-N-His)
PV036310 500 ng
EUR 329
RPS8 Protein Vector (Human) (pPM-C-HA)
PV036311 500 ng
EUR 329
RPS8 Protein Vector (Human) (pPM-C-His)
PV036312 500 ng
EUR 329
Rps8 3'UTR Luciferase Stable Cell Line
TU118173 1.0 ml Ask for price
Rps8 3'UTR GFP Stable Cell Line
TU168173 1.0 ml Ask for price
Rps8 3'UTR Luciferase Stable Cell Line
TU219715 1.0 ml Ask for price
Rps8 3'UTR GFP Stable Cell Line
TU269715 1.0 ml Ask for price
RPS8 3'UTR GFP Stable Cell Line
TU071870 1.0 ml
EUR 1394
RPS8 3'UTR Luciferase Stable Cell Line
TU021870 1.0 ml
EUR 1394
Rabbit 40S ribosomal protein S8(RPS8) ELISA kit
E04R0151-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S8(RPS8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S8(RPS8) ELISA kit
E04R0151-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S8(RPS8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit 40S ribosomal protein S8(RPS8) ELISA kit
E04R0151-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S8(RPS8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.