Protein Transport Protein Sec31A (SEC31A) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Transport Protein Sec31A (SEC31A) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Transport Protein Sec31A (SEC31A) Antibody
abx031415-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protein Transport Protein Sec31A (SEC31A) Antibody
abx031415-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Protein Transport Protein Sec31A (SEC31A) Antibody
abx224280-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Protein Transport Protein Sec31A (SEC31A) Antibody
abx237683-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Protein Transport Protein Sec31A (SEC31A) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Sec31a antibody
70R-9307 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Sec31a antibody
SEC31A Antibody
48427-100ul 100ul
EUR 333
SEC31A Antibody
48427-50ul 50ul
EUR 239
SEC31A antibody
70R-20145 50 ul
EUR 435
Description: Rabbit polyclonal SEC31A antibody
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SEC31A Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC31A. Recognizes SEC31A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SEC31A Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC31A. Recognizes SEC31A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Chicken Protein transport protein Sec31A, SEC31A ELISA KIT
ELI-20153c 96 Tests
EUR 928
Mouse Protein transport protein Sec31A, Sec31a ELISA KIT
ELI-45441m 96 Tests
EUR 865
Human Protein transport protein Sec31A, SEC31A ELISA KIT
ELI-30510h 96 Tests
EUR 824
Human Protein Transport Protein Sec31A (SEC31A) ELISA Kit
abx383089-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
SEC31A Conjugated Antibody
C48427 100ul
EUR 397
SEC31A cloning plasmid
CSB-CL020954HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1530
  • Sequence: atgaagttaaaggaagtagatcgtacagccatgcaggcatggagccctgcccagaatcaccccatttacctagcaacaggaacatctgctcagcaattggatgcaacatttagtacgaatgcttcccttgagatatttgaattagacctctctgatccatccttggatatgaaat
  • Show more
Description: A cloning plasmid for the SEC31A gene.
SEC31A cloning plasmid
CSB-CL020954HU2-10ug 10ug
EUR 1279
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3618
  • Sequence: atgaagttaaaggaagtagatcgtacagccatgcaggcatggagccctgcccagaatcaccccatttacctagcaacaggaacatctgctcagcaattggatgcaacatttagtacgaatgcttcccttgagatatttgaattagacctctctgatccatccttggatatgaaat
  • Show more
Description: A cloning plasmid for the SEC31A gene.
anti- SEC31A antibody
FNab07683 100µg
EUR 548.75
  • Immunogen: SEC31 homolog A(S. cerevisiae)
  • Uniprot ID: O94979
  • Gene ID: 22872
  • Research Area: Metabolism
Description: Antibody raised against SEC31A
SEC31A Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SEC31A Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SEC31A Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SEC31A Polyclonal Antibody
A60842 100 µg
EUR 570.55
Description: The best epigenetics products
SEC31A Rabbit pAb
A9321-100ul 100 ul
EUR 308
SEC31A Rabbit pAb
A9321-200ul 200 ul
EUR 459
SEC31A Rabbit pAb
A9321-20ul 20 ul
EUR 183
SEC31A Rabbit pAb
A9321-50ul 50 ul
EUR 223
Sec31a Blocking Peptide
33R-2016 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Sec31a antibody, catalog no. 70R-9307
Anti-SEC31A antibody
PAab07683 100 ug
EUR 386
Anti-SEC31A antibody
STJ111654 100 µl
EUR 277
Description: The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms.
Mouse SEC31A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat SEC31A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF002792 96 Tests
EUR 689
Human SEC31A shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SEC31A Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC31A. Recognizes SEC31A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SEC31A Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC31A. Recognizes SEC31A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SEC31A Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC31A. Recognizes SEC31A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SEC31A Polyclonal Antibody, Biotin Conjugated
A60843 100 µg
EUR 570.55
Description: kits suitable for this type of research
SEC31A Polyclonal Antibody, FITC Conjugated
A60844 100 µg
EUR 570.55
Description: fast delivery possible
SEC31A Polyclonal Antibody, HRP Conjugated
A60845 100 µg
EUR 570.55
Description: reagents widely cited
SEC31A ORF Vector (Human) (pORF)
ORF009305 1.0 ug DNA
EUR 95
Sec31a ORF Vector (Mouse) (pORF)
ORF056862 1.0 ug DNA
EUR 506
Sec31a ORF Vector (Rat) (pORF)
ORF075969 1.0 ug DNA
EUR 506
SEC31A ORF Vector (Human) (pORF)
ORF014385 1.0 ug DNA
EUR 354
SEC31A sgRNA CRISPR Lentivector set (Human)
K2113901 3 x 1.0 ug
EUR 339
Sec31a sgRNA CRISPR Lentivector set (Mouse)
K4731801 3 x 1.0 ug
EUR 339
Sec31a sgRNA CRISPR Lentivector set (Rat)
K7077201 3 x 1.0 ug
EUR 339
SEC31A sgRNA CRISPR Lentivector (Human) (Target 1)
K2113902 1.0 ug DNA
EUR 154
SEC31A sgRNA CRISPR Lentivector (Human) (Target 2)
K2113903 1.0 ug DNA
EUR 154
SEC31A sgRNA CRISPR Lentivector (Human) (Target 3)
K2113904 1.0 ug DNA
EUR 154
Sec31a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4731802 1.0 ug DNA
EUR 154
Sec31a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4731803 1.0 ug DNA
EUR 154
Sec31a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4731804 1.0 ug DNA
EUR 154
Sec31a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7077202 1.0 ug DNA
EUR 154
Sec31a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7077203 1.0 ug DNA
EUR 154
Sec31a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7077204 1.0 ug DNA
EUR 154
SEC31A Protein Vector (Human) (pPB-C-His)
PV057537 500 ng
EUR 481
SEC31A Protein Vector (Human) (pPB-N-His)
PV057538 500 ng
EUR 481
SEC31A Protein Vector (Human) (pPM-C-HA)
PV057539 500 ng
EUR 481
SEC31A Protein Vector (Human) (pPM-C-His)
PV057540 500 ng
EUR 481
SEC31A Protein Vector (Human) (pPB-C-His)
PV037217 500 ng
EUR 329
SEC31A Protein Vector (Human) (pPB-N-His)
PV037218 500 ng
EUR 329
SEC31A Protein Vector (Human) (pPM-C-HA)
PV037219 500 ng
EUR 329
SEC31A Protein Vector (Human) (pPM-C-His)
PV037220 500 ng
EUR 329
SEC31A Protein Vector (Rat) (pPB-C-His)
PV303874 500 ng
EUR 1191
SEC31A Protein Vector (Rat) (pPB-N-His)
PV303875 500 ng
EUR 1191
SEC31A Protein Vector (Rat) (pPM-C-HA)
PV303876 500 ng
EUR 1191
SEC31A Protein Vector (Rat) (pPM-C-His)
PV303877 500 ng
EUR 1191
SEC31A Protein Vector (Mouse) (pPB-C-His)
PV227446 500 ng
EUR 1065
SEC31A Protein Vector (Mouse) (pPB-N-His)
PV227447 500 ng
EUR 1065
SEC31A Protein Vector (Mouse) (pPM-C-HA)
PV227448 500 ng
EUR 1065
SEC31A Protein Vector (Mouse) (pPM-C-His)
PV227449 500 ng
EUR 1065
Sec31a 3'UTR GFP Stable Cell Line
TU168504 1.0 ml Ask for price
SEC31A 3'UTR Luciferase Stable Cell Line
TU022842 1.0 ml
EUR 4617
Sec31a 3'UTR Luciferase Stable Cell Line
TU118504 1.0 ml Ask for price
SEC31A 3'UTR GFP Stable Cell Line
TU072842 1.0 ml
EUR 4617
Sec31a 3'UTR Luciferase Stable Cell Line
TU220065 1.0 ml Ask for price
Sec31a 3'UTR GFP Stable Cell Line
TU270065 1.0 ml Ask for price
SEC31A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV666991 1.0 ug DNA
EUR 1355
SEC31A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV666995 1.0 ug DNA
EUR 1355