SEC31A

Protein Transport Protein Sec31A (SEC31A) Antibody
abx224280-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Protein Transport Protein Sec31A (SEC31A) Antibody
20-abx115402	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Protein Transport Protein Sec31A (SEC31A) Antibody
20-abx124186	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Protein Transport Protein Sec31A (SEC31A) Antibody
abx031415-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Protein Transport Protein Sec31A (SEC31A) Antibody
abx031415-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Protein Transport Protein Sec31A (SEC31A) Antibody
abx237683-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Protein Transport Protein Sec31A (SEC31A) Antibody
20-abx301278	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SEC31A antibody
70R-20145	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SEC31A antibody

SEC31A Antibody
48427-100ul	SAB	100ul	EUR 333

SEC31A Antibody
48427-50ul	SAB	50ul	EUR 239

Sec31a antibody
70R-9307	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Sec31a antibody

SEC31A Antibody
1-CSB-PA020954GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC31A. Recognizes SEC31A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SEC31A Antibody
1-CSB-PA020954LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC31A. Recognizes SEC31A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SEC31A siRNA
20-abx904840	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEC31A siRNA
20-abx932780	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEC31A siRNA
20-abx932781	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Chicken Protein transport protein Sec31A, SEC31A ELISA KIT
ELI-20153c	Lifescience Market	96 Tests	EUR 928

Human Protein transport protein Sec31A, SEC31A ELISA KIT
ELI-30510h	Lifescience Market	96 Tests	EUR 824

Mouse Protein transport protein Sec31A, Sec31a ELISA KIT
ELI-45441m	Lifescience Market	96 Tests	EUR 865

Human Protein Transport Protein Sec31A (SEC31A) ELISA Kit
abx383089-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Sec31a Blocking Peptide
33R-2016	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Sec31a antibody, catalog no. 70R-9307

SEC31A Conjugated Antibody
C48427	SAB	100ul	EUR 397

SEC31A Antibody (HRP)
20-abx305276	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SEC31A Antibody (FITC)
20-abx305277	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SEC31A Antibody (Biotin)
20-abx305278	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SEC31A cloning plasmid
CSB-CL020954HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1530 Sequence: atgaagttaaaggaagtagatcgtacagccatgcaggcatggagccctgcccagaatcaccccatttacctagcaacaggaacatctgctcagcaattggatgcaacatttagtacgaatgcttcccttgagatatttgaattagacctctctgatccatccttggatatgaaat Show more
Description: A cloning plasmid for the SEC31A gene.

SEC31A cloning plasmid
CSB-CL020954HU2-10ug	Cusabio	10ug	EUR 1279
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3618 Sequence: atgaagttaaaggaagtagatcgtacagccatgcaggcatggagccctgcccagaatcaccccatttacctagcaacaggaacatctgctcagcaattggatgcaacatttagtacgaatgcttcccttgagatatttgaattagacctctctgatccatccttggatatgaaat Show more
Description: A cloning plasmid for the SEC31A gene.

SEC31A Rabbit pAb
A9321-100ul	Abclonal	100 ul	EUR 308

SEC31A Rabbit pAb
A9321-200ul	Abclonal	200 ul	EUR 459

SEC31A Rabbit pAb
A9321-20ul	Abclonal	20 ul	EUR 183

SEC31A Rabbit pAb
A9321-50ul	Abclonal	50 ul	EUR 223

SEC31A Polyclonal Antibody
A60842	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

anti- SEC31A antibody
FNab07683	FN Test	100µg	EUR 548.75
Immunogen: SEC31 homolog A(S. cerevisiae) Uniprot ID: O94979 Gene ID: 22872 Research Area: Metabolism
Description: Antibody raised against SEC31A

Anti-SEC31A antibody
PAab07683	Lifescience Market	100 ug	EUR 386

Anti-SEC31A antibody
STJ111654	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms.

SEC31A ELISA KIT|Human
EF002792	Lifescience Market	96 Tests	EUR 689

Mouse SEC31A shRNA Plasmid
20-abx976868	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat SEC31A shRNA Plasmid
20-abx987069	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SEC31A Antibody, HRP conjugated
1-CSB-PA020954LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC31A. Recognizes SEC31A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SEC31A Antibody, FITC conjugated
1-CSB-PA020954LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC31A. Recognizes SEC31A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SEC31A Antibody, Biotin conjugated
1-CSB-PA020954LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SEC31A. Recognizes SEC31A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human SEC31A shRNA Plasmid
20-abx957829	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SEC31A Polyclonal Antibody, Biotin Conjugated
A60843	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SEC31A Polyclonal Antibody, FITC Conjugated
A60844	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

SEC31A Polyclonal Antibody, HRP Conjugated
A60845	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Sec31a ORF Vector (Rat) (pORF)
ORF075969	ABM	1.0 ug DNA	EUR 506

SEC31A ORF Vector (Human) (pORF)
ORF014385	ABM	1.0 ug DNA	EUR 354

SEC31A ORF Vector (Human) (pORF)
ORF009305	ABM	1.0 ug DNA	EUR 95

Sec31a ORF Vector (Mouse) (pORF)
ORF056862	ABM	1.0 ug DNA	EUR 506

Sec31a sgRNA CRISPR Lentivector set (Rat)
K7077201	ABM	3 x 1.0 ug	EUR 339

SEC31A sgRNA CRISPR Lentivector set (Human)
K2113901	ABM	3 x 1.0 ug	EUR 339

Sec31a sgRNA CRISPR Lentivector set (Mouse)
K4731801	ABM	3 x 1.0 ug	EUR 339

Sec31a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7077202	ABM	1.0 ug DNA	EUR 154

Sec31a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7077203	ABM	1.0 ug DNA	EUR 154

Sec31a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7077204	ABM	1.0 ug DNA	EUR 154

SEC31A sgRNA CRISPR Lentivector (Human) (Target 1)
K2113902	ABM	1.0 ug DNA	EUR 154

SEC31A sgRNA CRISPR Lentivector (Human) (Target 2)
K2113903	ABM	1.0 ug DNA	EUR 154

SEC31A sgRNA CRISPR Lentivector (Human) (Target 3)
K2113904	ABM	1.0 ug DNA	EUR 154

Sec31a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4731802	ABM	1.0 ug DNA	EUR 154

Sec31a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4731803	ABM	1.0 ug DNA	EUR 154

Sec31a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4731804	ABM	1.0 ug DNA	EUR 154

SEC31A Protein Vector (Rat) (pPB-C-His)
PV303874	ABM	500 ng	EUR 1191

SEC31A Protein Vector (Rat) (pPB-N-His)
PV303875	ABM	500 ng	EUR 1191

SEC31A Protein Vector (Rat) (pPM-C-HA)
PV303876	ABM	500 ng	EUR 1191

SEC31A Protein Vector (Rat) (pPM-C-His)
PV303877	ABM	500 ng	EUR 1191

SEC31A Protein Vector (Human) (pPB-C-His)
PV057537	ABM	500 ng	EUR 481

SEC31A Protein Vector (Human) (pPB-N-His)
PV057538	ABM	500 ng	EUR 481

SEC31A Protein Vector (Human) (pPM-C-HA)
PV057539	ABM	500 ng	EUR 481

SEC31A Protein Vector (Human) (pPM-C-His)
PV057540	ABM	500 ng	EUR 481

SEC31A Protein Vector (Mouse) (pPB-C-His)
PV227446	ABM	500 ng	EUR 1065

SEC31A Protein Vector (Mouse) (pPB-N-His)
PV227447	ABM	500 ng	EUR 1065

SEC31A Protein Vector (Mouse) (pPM-C-HA)
PV227448	ABM	500 ng	EUR 1065

SEC31A Protein Vector (Mouse) (pPM-C-His)
PV227449	ABM	500 ng	EUR 1065

SEC31A Protein Vector (Human) (pPB-C-His)
PV037217	ABM	500 ng	EUR 329

SEC31A Protein Vector (Human) (pPB-N-His)
PV037218	ABM	500 ng	EUR 329

SEC31A Protein Vector (Human) (pPM-C-HA)
PV037219	ABM	500 ng	EUR 329

SEC31A Protein Vector (Human) (pPM-C-His)
PV037220	ABM	500 ng	EUR 329

Sec31a 3'UTR Luciferase Stable Cell Line
TU118504	ABM	1.0 ml	Ask for price

Sec31a 3'UTR GFP Stable Cell Line
TU168504	ABM	1.0 ml	Ask for price

Sec31a 3'UTR Luciferase Stable Cell Line
TU220065	ABM	1.0 ml	Ask for price

Sec31a 3'UTR GFP Stable Cell Line
TU270065	ABM	1.0 ml	Ask for price

SEC31A 3'UTR GFP Stable Cell Line
TU072842	ABM	1.0 ml	EUR 4617

SEC31A 3'UTR Luciferase Stable Cell Line
TU022842	ABM	1.0 ml	EUR 4617

SEC31A Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV704355	ABM	1.0 ug DNA	EUR 450

SEC31A Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV704359	ABM	1.0 ug DNA	EUR 450