SLC25A13

SLC25A13 siRNA
20-abx933685
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC25A13 antibody
70R-20321 50 ul
EUR 435.00
Description: Rabbit polyclonal SLC25A13 antibody
SLC25A13 antibody
70R-13243 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal SLC25A13 antibody
SLC25A13 Antibody
ABD9303 100 ug
EUR 438.00
SLC25A13 Antibody
1-CSB-PA021479GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SLC25A13. Recognizes SLC25A13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SLC25A13 Antibody
1-CSB-PA982441
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC25A13. Recognizes SLC25A13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
SLC25A13 Antibody
DF9303 200ul
EUR 304.00
Description: SLC25A13 Antibody detects endogenous levels of total SLC25A13.
SLC25A13 Antibody
1-CSB-PA892444ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SLC25A13. Recognizes SLC25A13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000
SLC25A13 Antibody
1-CSB-PA892444ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SLC25A13. Recognizes SLC25A13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
SLC25A13 Antibody
33087-100ul 100ul
EUR 252.00
SLC25A13 antibody
22329-100ul 100ul
EUR 390.00
SLC25A13 Antibody
42757-100ul 100ul
EUR 252.00
SLC25A13 Antibody
1-CSB-PA037067
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC25A13. Recognizes SLC25A13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
anti-SLC25A13
YF-PA16757 50 ug
EUR 363.00
Description: Mouse polyclonal to SLC25A13
anti-SLC25A13
YF-PA16758 100 ug
EUR 403.00
Description: Rabbit polyclonal to SLC25A13
SLC25A13 Polyclonal Antibody
E-AB-11581-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2
  • Show more
Description: Rabbit antibody against Human,Mouse SLC25A13 for WB,IHC,ELISA applications.
SLC25A13 Polyclonal Antibody
E-AB-11581-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2
  • Show more
Description: Rabbit antibody against Human,Mouse SLC25A13 for WB,IHC,ELISA applications.
SLC25A13 Polyclonal Antibody
E-AB-11581-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2
  • Show more
Description: Rabbit antibody against Human,Mouse SLC25A13 for WB,IHC,ELISA applications.
Human SLC25A13 Protein
20-abx650894
  • EUR 537.00
  • EUR 244.00
  • EUR 1525.00
  • EUR 620.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
SLC25A13 Rabbit pAb
A5849-100ul 100 ul
EUR 308.00
SLC25A13 Rabbit pAb
A5849-200ul 200 ul
EUR 459.00
SLC25A13 Rabbit pAb
A5849-20ul 20 ul
EUR 183.00
SLC25A13 Rabbit pAb
A5849-50ul 50 ul
EUR 223.00
SLC25A13 Rabbit pAb
A12557-100ul 100 ul
EUR 308.00
SLC25A13 Rabbit pAb
A12557-200ul 200 ul
EUR 459.00
SLC25A13 Rabbit pAb
A12557-20ul 20 ul
EUR 183.00
SLC25A13 Rabbit pAb
A12557-50ul 50 ul
EUR 223.00
SLC25A13 Blocking Peptide
DF9303-BP 1mg
EUR 195.00
SLC25A13 cloning plasmid
CSB-CL892444HU-10ug 10ug
EUR 474.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2028
  • Sequence: atggcggccgccaaggtggctttaaccaagagagcagatccagctgagcttagaacaatatttttgaagtatgcaagcattgagaaaaacggtgaatttttcatgtcccccaatgactttgtcactcgatacttgaacatttttggagaaagccagcctaatccaaagactgtgg
  • Show more
Description: A cloning plasmid for the SLC25A13 gene.
Citrin (SLC25A13) Antibody
20-abx142229
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
SLC25A13 Conjugated Antibody
C42757 100ul
EUR 397.00
SLC25A13 Conjugated Antibody
C33087 100ul
EUR 397.00
Anti-SLC25A13 antibody
PAab07930 100 ug
EUR 386.00
anti- SLC25A13 antibody
FNab07930 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: solute carrier family 25, member 13 (citrin)
  • Uniprot ID: Q9UJS0
  • Gene ID: 10165
  • Research Area: Metabolism
Description: Antibody raised against SLC25A13
Anti-SLC25A13 antibody
STJ114431 100 µl
EUR 277.00
Description: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-SLC25A13 antibody
STJ28412 100 µl
EUR 277.00
Description: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-SLC25A13 (4F4)
YF-MA11253 100 ug
EUR 363.00
Description: Mouse monoclonal to SLC25A13
Human SLC25A13 shRNA Plasmid
20-abx956864
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SLC25A13 shRNA Plasmid
20-abx974137
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SLC25A13 ELISA Kit
ELA-E0318h 96 Tests
EUR 824.00
SLC25A13 ELISA KIT|Human
EF000560 96 Tests
EUR 689.00
SLC25A13 Recombinant Protein (Human)
RP028828 100 ug Ask for price
SLC25A13 Recombinant Protein (Mouse)
RP172580 100 ug Ask for price
SLC25A13 Recombinant Protein (Mouse)
RP172583 100 ug Ask for price
Slc25a13 ORF Vector (Mouse) (pORF)
ORF057528 1.0 ug DNA
EUR 506.00
Slc25a13 ORF Vector (Mouse) (pORF)
ORF057529 1.0 ug DNA
EUR 506.00
SLC25A13 ORF Vector (Human) (pORF)
ORF009610 1.0 ug DNA
EUR 95.00
SLC25A13 sgRNA CRISPR Lentivector set (Human)
K2177401 3 x 1.0 ug
EUR 339.00
Slc25a13 sgRNA CRISPR Lentivector set (Mouse)
K4971101 3 x 1.0 ug
EUR 339.00
Monoclonal SLC25A13 Antibody (monoclonal) (M01), Clone: 4F4
APR10046G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human SLC25A13 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4F4. This antibody is applicable in WB and IF, E
SLC25A13 Protein Vector (Human) (pPB-C-His)
PV038437 500 ng
EUR 329.00
SLC25A13 Protein Vector (Human) (pPB-N-His)
PV038438 500 ng
EUR 329.00
SLC25A13 Protein Vector (Human) (pPM-C-HA)
PV038439 500 ng
EUR 329.00
SLC25A13 Protein Vector (Human) (pPM-C-His)
PV038440 500 ng
EUR 329.00
SLC25A13 sgRNA CRISPR Lentivector (Human) (Target 1)
K2177402 1.0 ug DNA
EUR 154.00
SLC25A13 sgRNA CRISPR Lentivector (Human) (Target 2)
K2177403 1.0 ug DNA
EUR 154.00
SLC25A13 sgRNA CRISPR Lentivector (Human) (Target 3)
K2177404 1.0 ug DNA
EUR 154.00
Slc25a13 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4971102 1.0 ug DNA
EUR 154.00
Slc25a13 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4971103 1.0 ug DNA
EUR 154.00
Slc25a13 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4971104 1.0 ug DNA
EUR 154.00
SLC25A13 3'UTR Luciferase Stable Cell Line
TU023489 1.0 ml
EUR 1394.00
SLC25A13 Protein Vector (Mouse) (pPB-C-His)
PV230110 500 ng
EUR 1065.00
SLC25A13 Protein Vector (Mouse) (pPB-N-His)
PV230111 500 ng
EUR 1065.00
SLC25A13 Protein Vector (Mouse) (pPM-C-HA)
PV230112 500 ng
EUR 1065.00
SLC25A13 Protein Vector (Mouse) (pPM-C-His)
PV230113 500 ng
EUR 1065.00
SLC25A13 Protein Vector (Mouse) (pPB-C-His)
PV230114 500 ng
EUR 1065.00
SLC25A13 Protein Vector (Mouse) (pPB-N-His)
PV230115 500 ng
EUR 1065.00
SLC25A13 Protein Vector (Mouse) (pPM-C-HA)
PV230116 500 ng
EUR 1065.00
SLC25A13 Protein Vector (Mouse) (pPM-C-His)
PV230117 500 ng
EUR 1065.00
SLC25A13 3'UTR GFP Stable Cell Line
TU073489 1.0 ml
EUR 1394.00
Slc25a13 3'UTR Luciferase Stable Cell Line
TU220517 1.0 ml Ask for price
Slc25a13 3'UTR GFP Stable Cell Line
TU270517 1.0 ml Ask for price
Slc25a13 3'UTR GFP Stable Cell Line
TU168990 1.0 ml Ask for price
Slc25a13 3'UTR Luciferase Stable Cell Line
TU118990 1.0 ml Ask for price
Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
20-abx213197
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
20-abx213198
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
abx237930-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
20-abx322211
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
20-abx322277
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
20-abx004486
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Recombinant Solute Carrier Family 25 Member 13 (SLC25A13)
4-RPE463Hu01
  • EUR 373.28
  • EUR 203.00
  • EUR 1124.80
  • EUR 441.60
  • EUR 783.20
  • EUR 313.00
  • EUR 2662.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UJS0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.0kDa
  • Isoelectric Point: 9.6
Description: Recombinant Human Solute Carrier Family 25 Member 13 expressed in: E.coli
Solute Carrier Family 25, Member 13 (Citrin) (SLC25A13) Antibody
20-abx115680
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mouse Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) ELISA Kit
abx512584-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.
Human Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) ELISA Kit
abx253798-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.
Rat Calcium binding mitochondrial carrier protein Aralar2(SLC25A13) ELISA kit
E02C2429-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Calcium binding mitochondrial carrier protein Aralar2(SLC25A13) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.