SLC25A13

SLC25A13 siRNA
20-abx933685	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SLC25A13 antibody
70R-20321	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal SLC25A13 antibody

SLC25A13 antibody
70R-13243	Fitzgerald	100 ul	EUR 457.00
Description: Affinity purified Rabbit polyclonal SLC25A13 antibody

SLC25A13 Antibody
ABD9303	Lifescience Market	100 ug	EUR 438.00

SLC25A13 Antibody
1-CSB-PA021479GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SLC25A13. Recognizes SLC25A13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SLC25A13 Antibody
1-CSB-PA982441	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC25A13. Recognizes SLC25A13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

SLC25A13 Antibody
DF9303	Affbiotech	200ul	EUR 304.00
Description: SLC25A13 Antibody detects endogenous levels of total SLC25A13.

SLC25A13 Antibody
1-CSB-PA892444ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SLC25A13. Recognizes SLC25A13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

SLC25A13 Antibody
1-CSB-PA892444ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SLC25A13. Recognizes SLC25A13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SLC25A13 Antibody
33087-100ul	SAB	100ul	EUR 252.00

SLC25A13 antibody
22329-100ul	SAB	100ul	EUR 390.00

SLC25A13 Antibody
42757-100ul	SAB	100ul	EUR 252.00

SLC25A13 Antibody
1-CSB-PA037067	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC25A13. Recognizes SLC25A13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

anti-SLC25A13
YF-PA16757	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to SLC25A13

anti-SLC25A13
YF-PA16758	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to SLC25A13

SLC25A13 Polyclonal Antibody
E-AB-11581-120uL	Elabscience Biotechnology	120uL	EUR 257.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2 Show more
Description: Rabbit antibody against Human,Mouse SLC25A13 for WB,IHC,ELISA applications.

SLC25A13 Polyclonal Antibody
E-AB-11581-20uL	Elabscience Biotechnology	20uL	EUR 130.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2 Show more
Description: Rabbit antibody against Human,Mouse SLC25A13 for WB,IHC,ELISA applications.

SLC25A13 Polyclonal Antibody
E-AB-11581-60uL	Elabscience Biotechnology	60uL	EUR 175.00
Conjugation: Unconjugated Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3 Purified by: Affinity purification Background: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2 Show more
Description: Rabbit antibody against Human,Mouse SLC25A13 for WB,IHC,ELISA applications.

Human SLC25A13 Protein
20-abx650894	Abbexa	EUR 537.00 EUR 244.00 EUR 1525.00 EUR 620.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

SLC25A13 Rabbit pAb
A5849-100ul	Abclonal	100 ul	EUR 308.00

SLC25A13 Rabbit pAb
A5849-200ul	Abclonal	200 ul	EUR 459.00

SLC25A13 Rabbit pAb
A5849-20ul	Abclonal	20 ul	EUR 183.00

SLC25A13 Rabbit pAb
A5849-50ul	Abclonal	50 ul	EUR 223.00

SLC25A13 Rabbit pAb
A12557-100ul	Abclonal	100 ul	EUR 308.00

SLC25A13 Rabbit pAb
A12557-200ul	Abclonal	200 ul	EUR 459.00

SLC25A13 Rabbit pAb
A12557-20ul	Abclonal	20 ul	EUR 183.00

SLC25A13 Rabbit pAb
A12557-50ul	Abclonal	50 ul	EUR 223.00

SLC25A13 Blocking Peptide
DF9303-BP	Affbiotech	1mg	EUR 195.00

SLC25A13 cloning plasmid
CSB-CL892444HU-10ug	Cusabio	10ug	EUR 474.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2028 Sequence: atggcggccgccaaggtggctttaaccaagagagcagatccagctgagcttagaacaatatttttgaagtatgcaagcattgagaaaaacggtgaatttttcatgtcccccaatgactttgtcactcgatacttgaacatttttggagaaagccagcctaatccaaagactgtgg Show more
Description: A cloning plasmid for the SLC25A13 gene.

Citrin (SLC25A13) Antibody
20-abx142229	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

SLC25A13 Conjugated Antibody
C42757	SAB	100ul	EUR 397.00

SLC25A13 Conjugated Antibody
C33087	SAB	100ul	EUR 397.00

Anti-SLC25A13 antibody
PAab07930	Lifescience Market	100 ug	EUR 386.00

anti- SLC25A13 antibody
FNab07930	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: solute carrier family 25, member 13 (citrin) Uniprot ID: Q9UJS0 Gene ID: 10165 Research Area: Metabolism
Description: Antibody raised against SLC25A13

Anti-SLC25A13 antibody
STJ114431	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-SLC25A13 antibody
STJ28412	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-SLC25A13 (4F4)
YF-MA11253	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to SLC25A13

Human SLC25A13 shRNA Plasmid
20-abx956864	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SLC25A13 shRNA Plasmid
20-abx974137	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SLC25A13 ELISA Kit
ELA-E0318h	Lifescience Market	96 Tests	EUR 824.00

SLC25A13 ELISA KIT|Human
EF000560	Lifescience Market	96 Tests	EUR 689.00

SLC25A13 Recombinant Protein (Human)
RP028828	ABM	100 ug	Ask for price

SLC25A13 Recombinant Protein (Mouse)
RP172580	ABM	100 ug	Ask for price

SLC25A13 Recombinant Protein (Mouse)
RP172583	ABM	100 ug	Ask for price

Slc25a13 ORF Vector (Mouse) (pORF)
ORF057528	ABM	1.0 ug DNA	EUR 506.00

Slc25a13 ORF Vector (Mouse) (pORF)
ORF057529	ABM	1.0 ug DNA	EUR 506.00

SLC25A13 ORF Vector (Human) (pORF)
ORF009610	ABM	1.0 ug DNA	EUR 95.00

SLC25A13 sgRNA CRISPR Lentivector set (Human)
K2177401	ABM	3 x 1.0 ug	EUR 339.00

Slc25a13 sgRNA CRISPR Lentivector set (Mouse)
K4971101	ABM	3 x 1.0 ug	EUR 339.00

Monoclonal SLC25A13 Antibody (monoclonal) (M01), Clone: 4F4
APR10046G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human SLC25A13 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4F4. This antibody is applicable in WB and IF, E

SLC25A13 Protein Vector (Human) (pPB-C-His)
PV038437	ABM	500 ng	EUR 329.00

SLC25A13 Protein Vector (Human) (pPB-N-His)
PV038438	ABM	500 ng	EUR 329.00

SLC25A13 Protein Vector (Human) (pPM-C-HA)
PV038439	ABM	500 ng	EUR 329.00

SLC25A13 Protein Vector (Human) (pPM-C-His)
PV038440	ABM	500 ng	EUR 329.00

SLC25A13 sgRNA CRISPR Lentivector (Human) (Target 1)
K2177402	ABM	1.0 ug DNA	EUR 154.00

SLC25A13 sgRNA CRISPR Lentivector (Human) (Target 2)
K2177403	ABM	1.0 ug DNA	EUR 154.00

SLC25A13 sgRNA CRISPR Lentivector (Human) (Target 3)
K2177404	ABM	1.0 ug DNA	EUR 154.00

Slc25a13 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4971102	ABM	1.0 ug DNA	EUR 154.00

Slc25a13 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4971103	ABM	1.0 ug DNA	EUR 154.00

Slc25a13 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4971104	ABM	1.0 ug DNA	EUR 154.00

SLC25A13 3'UTR Luciferase Stable Cell Line
TU023489	ABM	1.0 ml	EUR 1394.00

SLC25A13 Protein Vector (Mouse) (pPB-C-His)
PV230110	ABM	500 ng	EUR 1065.00

SLC25A13 Protein Vector (Mouse) (pPB-N-His)
PV230111	ABM	500 ng	EUR 1065.00

SLC25A13 Protein Vector (Mouse) (pPM-C-HA)
PV230112	ABM	500 ng	EUR 1065.00

SLC25A13 Protein Vector (Mouse) (pPM-C-His)
PV230113	ABM	500 ng	EUR 1065.00

SLC25A13 Protein Vector (Mouse) (pPB-C-His)
PV230114	ABM	500 ng	EUR 1065.00

SLC25A13 Protein Vector (Mouse) (pPB-N-His)
PV230115	ABM	500 ng	EUR 1065.00

SLC25A13 Protein Vector (Mouse) (pPM-C-HA)
PV230116	ABM	500 ng	EUR 1065.00

SLC25A13 Protein Vector (Mouse) (pPM-C-His)
PV230117	ABM	500 ng	EUR 1065.00

SLC25A13 3'UTR GFP Stable Cell Line
TU073489	ABM	1.0 ml	EUR 1394.00

Slc25a13 3'UTR Luciferase Stable Cell Line
TU220517	ABM	1.0 ml	Ask for price

Slc25a13 3'UTR GFP Stable Cell Line
TU270517	ABM	1.0 ml	Ask for price

Slc25a13 3'UTR GFP Stable Cell Line
TU168990	ABM	1.0 ml	Ask for price

Slc25a13 3'UTR Luciferase Stable Cell Line
TU118990	ABM	1.0 ml	Ask for price

Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
20-abx213197	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
20-abx213198	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
abx237930-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
20-abx322211	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
20-abx322277	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) Antibody
20-abx004486	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Solute Carrier Family 25 Member 13 (SLC25A13)
4-RPE463Hu01	Cloud-Clone	EUR 373.28 EUR 203.00 EUR 1124.80 EUR 441.60 EUR 783.20 EUR 313.00 EUR 2662.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UJS0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.0kDa Isoelectric Point: 9.6
Description: Recombinant Human Solute Carrier Family 25 Member 13 expressed in: E.coli

Solute Carrier Family 25, Member 13 (Citrin) (SLC25A13) Antibody
20-abx115680	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Mouse Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) ELISA Kit
abx512584-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Human Calcium-Binding Mitochondrial Carrier Protein Aralar2 (SLC25A13) ELISA Kit
abx253798-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Rat Calcium binding mitochondrial carrier protein Aralar2(SLC25A13) ELISA kit
E02C2429-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Calcium binding mitochondrial carrier protein Aralar2(SLC25A13) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.