SLC35A1 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SLC35A1. Recognizes SLC35A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
SLC35A1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SLC35A1. Recognizes SLC35A1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC35A1 Rabbit pAb
A10658-100ul 100 ul
EUR 308
SLC35A1 Rabbit pAb
A10658-200ul 200 ul
EUR 459
SLC35A1 Rabbit pAb
A10658-20ul 20 ul
EUR 183
SLC35A1 Rabbit pAb
A10658-50ul 50 ul
EUR 223
SLC35A1 cloning plasmid
CSB-CL021583HU-10ug 10ug
EUR 394
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1014
  • Sequence: atggctgccccgagagacaatgtcactttattattcaagttatactgcttggcagtgatgaccctgatggctgcagtctataccatagctttaagatacacaaggacatcagacaaagaactctacttttcaaccacagccgtgtgtatcacagaagttataaagttattgctaa
  • Show more
Description: A cloning plasmid for the SLC35A1 gene.
anti- SLC35A1 antibody
FNab07953 100µg
EUR 548.75
  • Immunogen: solute carrier family 35(CMP-sialic acid transporter), member A1
  • Uniprot ID: P78382
  • Gene ID: 10559
  • Research Area: Metabolism
Description: Antibody raised against SLC35A1
Anti-SLC35A1 antibody
PAab07953 100 ug
EUR 386
Anti-SLC35A1 antibody
STJ118017 100 µl
EUR 277
Description: The protein encoded by this gene is found in the membrane of the Golgi apparatus, where it transports nucleotide sugars into the Golgi. One such nucleotide sugar is CMP-sialic acid, which is imported into the Golgi by the encoded protein and subsequently glycosylated. Defects in this gene are a cause of congenital disorder of glycosylation type 2F (CDG2F). Two transcript variants encoding different isoforms have been found for this gene.
EF003002 96 Tests
EUR 689
Mouse SLC35A1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SLC35A1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SLC35A1 Recombinant Protein (Human)
RP029011 100 ug Ask for price
SLC35A1 Recombinant Protein (Rat)
RP229433 100 ug Ask for price
SLC35A1 Recombinant Protein (Mouse)
RP172919 100 ug Ask for price
Slc35a1 ORF Vector (Rat) (pORF)
ORF076479 1.0 ug DNA
EUR 506
SLC35A1 ORF Vector (Human) (pORF)
ORF009671 1.0 ug DNA
EUR 95
Slc35a1 ORF Vector (Mouse) (pORF)
ORF057641 1.0 ug DNA
EUR 506
CMP-Sialic Acid Transporter (SLC35A1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
CMP-Sialic Acid Transporter (SLC35A1) Antibody
abx237953-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
CMP-Sialic Acid Transporter (SLC35A1) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Slc35a1 sgRNA CRISPR Lentivector set (Rat)
K6096601 3 x 1.0 ug
EUR 339
Slc35a1 sgRNA CRISPR Lentivector set (Mouse)
K4932501 3 x 1.0 ug
EUR 339
SLC35A1 sgRNA CRISPR Lentivector set (Human)
K2185201 3 x 1.0 ug
EUR 339
Slc35a1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6096602 1.0 ug DNA
EUR 154
Slc35a1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6096603 1.0 ug DNA
EUR 154
Slc35a1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6096604 1.0 ug DNA
EUR 154
Slc35a1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4932502 1.0 ug DNA
EUR 154
Slc35a1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4932503 1.0 ug DNA
EUR 154
Slc35a1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4932504 1.0 ug DNA
EUR 154
SLC35A1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2185202 1.0 ug DNA
EUR 154
SLC35A1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2185203 1.0 ug DNA
EUR 154
SLC35A1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2185204 1.0 ug DNA
EUR 154
SLC35A1 Protein Vector (Rat) (pPB-C-His)
PV305914 500 ng
EUR 603
SLC35A1 Protein Vector (Rat) (pPB-N-His)
PV305915 500 ng
EUR 603
SLC35A1 Protein Vector (Rat) (pPM-C-HA)
PV305916 500 ng
EUR 603
SLC35A1 Protein Vector (Rat) (pPM-C-His)
PV305917 500 ng
EUR 603
SLC35A1 Protein Vector (Human) (pPB-C-His)
PV038681 500 ng
EUR 329
SLC35A1 Protein Vector (Human) (pPB-N-His)
PV038682 500 ng
EUR 329
SLC35A1 Protein Vector (Human) (pPM-C-HA)
PV038683 500 ng
EUR 329
SLC35A1 Protein Vector (Human) (pPM-C-His)
PV038684 500 ng
EUR 329
SLC35A1 Protein Vector (Mouse) (pPB-C-His)
PV230562 500 ng
EUR 603
SLC35A1 Protein Vector (Mouse) (pPB-N-His)
PV230563 500 ng
EUR 603
SLC35A1 Protein Vector (Mouse) (pPM-C-HA)
PV230564 500 ng
EUR 603
SLC35A1 Protein Vector (Mouse) (pPM-C-His)
PV230565 500 ng
EUR 603
Slc35a1 3'UTR Luciferase Stable Cell Line
TU119083 1.0 ml Ask for price
Slc35a1 3'UTR GFP Stable Cell Line
TU169083 1.0 ml Ask for price
Slc35a1 3'UTR Luciferase Stable Cell Line
TU220607 1.0 ml Ask for price
Slc35a1 3'UTR GFP Stable Cell Line
TU270607 1.0 ml Ask for price
SLC35A1 3'UTR GFP Stable Cell Line
TU073569 1.0 ml
EUR 1394
SLC35A1 3'UTR Luciferase Stable Cell Line
TU023569 1.0 ml
EUR 1394
Rat CMP sialic acid transporter(SLC35A1) ELISA kit
E02C2435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat CMP sialic acid transporter(SLC35A1) ELISA kit
E02C2435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat CMP sialic acid transporter(SLC35A1) ELISA kit
E02C2435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CMP sialic acid transporter(SLC35A1) ELISA kit
E01C2435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CMP sialic acid transporter(SLC35A1) ELISA kit
E01C2435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CMP sialic acid transporter(SLC35A1) ELISA kit
E01C2435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse CMP sialic acid transporter(SLC35A1) ELISA kit
E03C2435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse CMP sialic acid transporter(SLC35A1) ELISA kit
E03C2435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse CMP sialic acid transporter(SLC35A1) ELISA kit
E03C2435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat CMP sialic acid transporter(SLC35A1) ELISA kit
E06C2435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat CMP sialic acid transporter(SLC35A1) ELISA kit
E06C2435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat CMP sialic acid transporter(SLC35A1) ELISA kit
E06C2435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CMP sialic acid transporter(SLC35A1) ELISA kit
E04C2435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CMP sialic acid transporter(SLC35A1) ELISA kit
E04C2435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit CMP sialic acid transporter(SLC35A1) ELISA kit
E04C2435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey CMP sialic acid transporter(SLC35A1) ELISA kit
E09C2435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey CMP sialic acid transporter(SLC35A1) ELISA kit
E09C2435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey CMP sialic acid transporter(SLC35A1) ELISA kit
E09C2435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog CMP sialic acid transporter(SLC35A1) ELISA kit
E08C2435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog CMP sialic acid transporter(SLC35A1) ELISA kit
E08C2435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog CMP sialic acid transporter(SLC35A1) ELISA kit
E08C2435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig CMP sialic acid transporter(SLC35A1) ELISA kit
E07C2435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig CMP sialic acid transporter(SLC35A1) ELISA kit
E07C2435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig CMP sialic acid transporter(SLC35A1) ELISA kit
E07C2435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human CMP- sialic acid transporter, SLC35A1 ELISA KIT
ELI-13478h 96 Tests
EUR 824
Mouse CMP- sialic acid transporter, Slc35a1 ELISA KIT
ELI-29559m 96 Tests
EUR 865
Human CMP-sialic acid transporter (SLC35A1) ELISA Kit
abx383261-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse CMP-sialic acid transporter (SLC35A1) ELISA Kit
abx388891-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Guinea pig CMP sialic acid transporter(SLC35A1) ELISA kit
E05C2435-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig CMP sialic acid transporter(SLC35A1) ELISA kit
E05C2435-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig CMP sialic acid transporter(SLC35A1) ELISA kit
E05C2435-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig CMP sialic acid transporter(SLC35A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.