ST3GAL4

ST3GAL4 Antibody
1-CSB-PA022754GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ST3GAL4. Recognizes ST3GAL4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ST3GAL4 Antibody
1-CSB-PA612121LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST3GAL4. Recognizes ST3GAL4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500
ST3GAL4 antibody
38813-100ul 100ul
EUR 252.00
ST3GAL4 antibody
70R-20548 50 ul
EUR 435.00
Description: Rabbit polyclonal ST3GAL4 antibody
ST3GAL4 antibody
70R-7331 50 ug
EUR 467.00
Description: Rabbit polyclonal ST3GAL4 antibody raised against the middle region of ST3GAL4
ST3GAL4 antibody
70R-7391 50 ug
EUR 467.00
Description: Rabbit polyclonal ST3GAL4 antibody raised against the middle region of ST3GAL4
ST3GAL4 siRNA
20-abx905307
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ST3GAL4 siRNA
20-abx935318
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ST3GAL4 siRNA
20-abx935319
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ST3GAL4
YF-PA24702 50 ul
EUR 334.00
Description: Mouse polyclonal to ST3GAL4
ST3GAL4 Conjugated Antibody
C38813 100ul
EUR 397.00
ST3GAL4 cloning plasmid
CSB-CL612121HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atggtcagcaagtcccgctggaagctcctggccatgttggctctggtcctggtcgtcatggtgtggtattccatctcccgggaagacaggtacatcgagcttttttattttcccatcccagagaagaaggagccgtgcctccagggtgaggcagagagcaaggcctctaagctct
  • Show more
Description: A cloning plasmid for the ST3GAL4 gene.
ST3GAL4 Blocking Peptide
33R-2869 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST3GAL4 antibody, catalog no. 70R-7391
ST3GAL4 Blocking Peptide
33R-4030 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST3GAL4 antibody, catalog no. 70R-7331
ST3GAL4 Polyclonal Antibody
A69839 100 ?g
EUR 628.55
Description: Ask the seller for details
ST3GAL4 Rabbit pAb
A6309-100ul 100 ul
EUR 308.00
ST3GAL4 Rabbit pAb
A6309-200ul 200 ul
EUR 459.00
ST3GAL4 Rabbit pAb
A6309-20ul 20 ul
EUR 183.00
ST3GAL4 Rabbit pAb
A6309-50ul 50 ul
EUR 223.00
ST3GAL4 Rabbit pAb
A13544-100ul 100 ul
EUR 308.00
ST3GAL4 Rabbit pAb
A13544-200ul 200 ul
EUR 459.00
ST3GAL4 Rabbit pAb
A13544-20ul 20 ul
EUR 183.00
ST3GAL4 Rabbit pAb
A13544-50ul 50 ul
EUR 223.00
ST3GAL4 Rabbit pAb
A14491-200ul 200 ul
EUR 459.00
ST3GAL4 Rabbit pAb
A14491-50ul 50 ul
EUR 223.00
ST3GAL4 Rabbit pAb
A14491-100ul 100 ul
EUR 308.00
ST3GAL4 Rabbit pAb
A14491-20ul 20 ul
EUR 183.00
anti- ST3GAL4 antibody
FNab08265 100µg
EUR 548.75
  • Immunogen: ST3 beta-galactoside alpha-2,3-sialyltransferase 4
  • Uniprot ID: Q11206
  • Gene ID: 6484
  • Research Area: Metabolism
Description: Antibody raised against ST3GAL4
Anti-ST3GAL4 antibody
PAab08265 100 ug
EUR 386.00
pcDNA3.1(-)-ST3GAL4 Plasmid
PVTB00892-2a 2 ug
EUR 356.00
pCMV-SPORT6-ST3GAL4
PVT13849 2 ug
EUR 391.00
Anti-ST3GAL4 antibody
STJ115505 100 µl
EUR 277.00
Description: This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-ST3GAL4 antibody
STJ116702 100 µl
EUR 277.00
Description: This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-ST3GAL4 antibody
STJ28231 100 µl
EUR 277.00
Description: This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-ST3GAL4 (1F4)
YF-MA15414 100 ug
EUR 363.00
Description: Mouse monoclonal to ST3GAL4
Rat ST3GAL4 shRNA Plasmid
20-abx990493
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ST3GAL4 Antibody, HRP conjugated
1-CSB-PA612121LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST3GAL4. Recognizes ST3GAL4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ST3GAL4 Antibody, FITC conjugated
1-CSB-PA612121LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST3GAL4. Recognizes ST3GAL4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ST3GAL4 Antibody, Biotin conjugated
1-CSB-PA612121LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST3GAL4. Recognizes ST3GAL4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human ST3GAL4 shRNA Plasmid
20-abx954383
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ST3GAL4 shRNA Plasmid
20-abx972692
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ST3GAL4 ELISA KIT
ELI-29701h 96 Tests
EUR 824.00
Mouse St3gal4 ELISA KIT
ELI-36077m 96 Tests
EUR 865.00
ST3GAL4 ELISA KIT|Human
EF003263 96 Tests
EUR 689.00
ST3GAL4 Recombinant Protein (Human)
RP030226 100 ug Ask for price
ST3GAL4 Recombinant Protein (Mouse)
RP175760 100 ug Ask for price
ST3GAL4 Recombinant Protein (Rat)
RP231242 100 ug Ask for price
ST3GAL4 Polyclonal Antibody, HRP Conjugated
A69840 100 ?g
EUR 628.55
Description: The best epigenetics products
ST3GAL4 Polyclonal Antibody, FITC Conjugated
A69841 100 ?g
EUR 628.55
Description: kits suitable for this type of research
ST3GAL4 Polyclonal Antibody, Biotin Conjugated
A69842 100 ?g
EUR 628.55
Description: fast delivery possible
ST3GAL4 ORF Vector (Human) (pORF)
ORF010076 1.0 ug DNA
EUR 95.00
St3gal4 ORF Vector (Rat) (pORF)
ORF077082 1.0 ug DNA
EUR 506.00
St3gal4 ORF Vector (Mouse) (pORF)
ORF058588 1.0 ug DNA
EUR 506.00
ST3GAL4 sgRNA CRISPR Lentivector set (Human)
K2294401 3 x 1.0 ug
EUR 339.00
St3gal4 sgRNA CRISPR Lentivector set (Mouse)
K4901501 3 x 1.0 ug
EUR 339.00
St3gal4 sgRNA CRISPR Lentivector set (Rat)
K7200201 3 x 1.0 ug
EUR 339.00
ST3GAL4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2294402 1.0 ug DNA
EUR 154.00
ST3GAL4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2294403 1.0 ug DNA
EUR 154.00
ST3GAL4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2294404 1.0 ug DNA
EUR 154.00
St3gal4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4901502 1.0 ug DNA
EUR 154.00
St3gal4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4901503 1.0 ug DNA
EUR 154.00
St3gal4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4901504 1.0 ug DNA
EUR 154.00
St3gal4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7200202 1.0 ug DNA
EUR 154.00
St3gal4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7200203 1.0 ug DNA
EUR 154.00
St3gal4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7200204 1.0 ug DNA
EUR 154.00
ST3GAL4 Protein Vector (Rat) (pPB-C-His)
PV308326 500 ng
EUR 603.00
ST3GAL4 Protein Vector (Rat) (pPB-N-His)
PV308327 500 ng
EUR 603.00
ST3GAL4 Protein Vector (Rat) (pPM-C-HA)
PV308328 500 ng
EUR 603.00
ST3GAL4 Protein Vector (Rat) (pPM-C-His)
PV308329 500 ng
EUR 603.00
ST3GAL4 Protein Vector (Mouse) (pPB-C-His)
PV234350 500 ng
EUR 603.00
ST3GAL4 Protein Vector (Mouse) (pPB-N-His)
PV234351 500 ng
EUR 603.00
ST3GAL4 Protein Vector (Mouse) (pPM-C-HA)
PV234352 500 ng
EUR 603.00
ST3GAL4 Protein Vector (Mouse) (pPM-C-His)
PV234353 500 ng
EUR 603.00
ST3GAL4 Protein Vector (Human) (pPB-C-His)
PV040301 500 ng
EUR 329.00
ST3GAL4 Protein Vector (Human) (pPB-N-His)
PV040302 500 ng
EUR 329.00
ST3GAL4 Protein Vector (Human) (pPM-C-HA)
PV040303 500 ng
EUR 329.00
ST3GAL4 Protein Vector (Human) (pPM-C-His)
PV040304 500 ng
EUR 329.00
St3gal4 3'UTR Luciferase Stable Cell Line
TU119771 1.0 ml Ask for price
ST3GAL4 3'UTR Luciferase Stable Cell Line
TU024704 1.0 ml
EUR 1521.00
St3gal4 3'UTR GFP Stable Cell Line
TU169771 1.0 ml Ask for price
ST3GAL4 3'UTR GFP Stable Cell Line
TU074704 1.0 ml
EUR 1521.00
St3gal4 3'UTR Luciferase Stable Cell Line
TU221240 1.0 ml Ask for price
St3gal4 3'UTR GFP Stable Cell Line
TU271240 1.0 ml Ask for price
ST3GAL4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV690493 1.0 ug DNA
EUR 682.00
ST3GAL4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV690497 1.0 ug DNA
EUR 682.00