ST6GALNAC6 antibody
70R-6867 50 ug
EUR 467
Description: Rabbit polyclonal ST6GALNAC6 antibody raised against the C terminal of ST6GALNAC6
ST6GALNAC6 antibody
70R-8664 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ST6GALNAC6 antibody
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA18695 50 ul
EUR 363
Description: Mouse polyclonal to ST6GALNAC6
YF-PA18696 50 ug
EUR 363
Description: Mouse polyclonal to ST6GALNAC6
YF-PA18697 50 ul
EUR 363
Description: Mouse polyclonal to ST6GALNAC6
YF-PA18698 50 ug
EUR 363
Description: Mouse polyclonal to ST6GALNAC6
ST6GALNAC6 Blocking Peptide
33R-10129 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST6GALNAC6 antibody, catalog no. 70R-6867
ST6GALNAC6 Blocking Peptide
33R-1341 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC12A3 antibody, catalog no. 70R-6605
ST6GALNAC6 cloning plasmid
CSB-CL850251HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1002
  • Sequence: atggcttgctcgaggccccccagccagtgtgaacccacatccctgcccccagggccacctgcaggacgccgacacctacccctcagcagacgccggagagaaatgagtagcaacaaagagcagcggtcagcagtgttcgtgatcctctttgccctcatcaccatcctcatcctct
  • Show more
Description: A cloning plasmid for the ST6GALNAC6 gene.
ST6GALNAC6 Polyclonal Antibody
A61162 100 µg
EUR 570.55
Description: The best epigenetics products
anti- ST6GALNAC6 antibody
FNab08272 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: ST6(alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
  • Uniprot ID: Q969X2
  • Gene ID: 30815
  • Research Area: Metabolism
Description: Antibody raised against ST6GALNAC6
ST6GALNAC6 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC6. Recognizes ST6GALNAC6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ST6GALNAC6 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC6. Recognizes ST6GALNAC6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ST6GALNAC6 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC6. Recognizes ST6GALNAC6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse St6galnac6 ELISA KIT
ELI-18664m 96 Tests
EUR 865
ELI-29704h 96 Tests
EUR 824
EF003269 96 Tests
EUR 689
Mouse ST6GALNAC6 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ST6GALNAC6 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-40845b 96 Tests
EUR 928
ST6GALNAC6 Recombinant Protein (Human)
RP030253 100 ug Ask for price
ST6GALNAC6 Recombinant Protein (Mouse)
RP175805 100 ug Ask for price
ST6GALNAC6 Recombinant Protein (Mouse)
RP175808 100 ug Ask for price
ST6GALNAC6 Recombinant Protein (Mouse)
RP175811 100 ug Ask for price
ST6GALNAC6 Polyclonal Antibody, Biotin Conjugated
A61163 100 µg
EUR 570.55
Description: kits suitable for this type of research
ST6GALNAC6 Polyclonal Antibody, FITC Conjugated
A61164 100 µg
EUR 570.55
Description: fast delivery possible
ST6GALNAC6 Polyclonal Antibody, HRP Conjugated
A61165 100 µg
EUR 570.55
Description: reagents widely cited
ST6GALNAC6 ORF Vector (Human) (pORF)
ORF010085 1.0 ug DNA
EUR 95
St6galnac6 ORF Vector (Mouse) (pORF)
ORF058603 1.0 ug DNA
EUR 506
St6galnac6 ORF Vector (Mouse) (pORF)
ORF058604 1.0 ug DNA
EUR 506
St6galnac6 ORF Vector (Mouse) (pORF)
ORF058605 1.0 ug DNA
EUR 506
ST6GALNAC6 sgRNA CRISPR Lentivector set (Human)
K2295601 3 x 1.0 ug
EUR 339
St6galnac6 sgRNA CRISPR Lentivector set (Mouse)
K4731001 3 x 1.0 ug
EUR 339
ST6GALNAC6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2295602 1.0 ug DNA
EUR 154
ST6GALNAC6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2295603 1.0 ug DNA
EUR 154
ST6GALNAC6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2295604 1.0 ug DNA
EUR 154
St6galnac6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4731002 1.0 ug DNA
EUR 154
St6galnac6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4731003 1.0 ug DNA
EUR 154
St6galnac6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4731004 1.0 ug DNA
EUR 154
ST6GALNAC6 Protein Vector (Human) (pPB-C-His)
PV040337 500 ng
EUR 329
ST6GALNAC6 Protein Vector (Human) (pPB-N-His)
PV040338 500 ng
EUR 329
ST6GALNAC6 Protein Vector (Human) (pPM-C-HA)
PV040339 500 ng
EUR 329
ST6GALNAC6 Protein Vector (Human) (pPM-C-His)
PV040340 500 ng
EUR 329
ST6GALNAC6 Protein Vector (Mouse) (pPB-C-His)
PV234410 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPB-N-His)
PV234411 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPM-C-HA)
PV234412 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPM-C-His)
PV234413 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPB-C-His)
PV234414 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPB-N-His)
PV234415 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPM-C-HA)
PV234416 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPM-C-His)
PV234417 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPB-C-His)
PV234418 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPB-N-His)
PV234419 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPM-C-HA)
PV234420 500 ng
EUR 603
ST6GALNAC6 Protein Vector (Mouse) (pPM-C-His)
PV234421 500 ng
EUR 603
St6galnac6 3'UTR Luciferase Stable Cell Line
TU119782 1.0 ml Ask for price
St6galnac6 3'UTR GFP Stable Cell Line
TU169782 1.0 ml Ask for price
ST6GALNAC6 3'UTR GFP Stable Cell Line
TU074716 1.0 ml
EUR 1521
ST6GALNAC6 3'UTR Luciferase Stable Cell Line
TU024716 1.0 ml
EUR 1521
Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 6 (ST6GALNAC6) Antibody
abx145691-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 6 (ST6GALNAC6) Antibody
abx238272-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 6 (ST6GALNAC6) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 6 (ST6GALNAC6) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 6 (ST6GALNAC6) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 6 (ST6GALNAC6) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ST6GALNAC6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2295605 3 x 1.0 ug
EUR 376
St6galnac6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4731005 3 x 1.0 ug
EUR 376
Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E01A1996-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E01A1996-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E01A1996-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E03A1996-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E03A1996-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E03A1996-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E06A1996-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E06A1996-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E06A1996-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E04A1996-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E04A1996-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E04A1996-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E02A1996-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E02A1996-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E02A1996-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) ELISA kit
E07A1996-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 6(ST6GALNAC6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.