TAZ

Human Tafazzin (TAZ) ELISA Kit
DLR-TAZ-Hu-96T 96T
EUR 673.00
  • Should the Human Tafazzin (TAZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tafazzin (TAZ) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Tafazzin (TAZ) ELISA Kit
DL-TAZ-Hu-192 1 kit of 192 tests
EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tafazzin (TAZ)
Human Tafazzin (TAZ) ELISA Kit
DL-TAZ-Hu-48 1 kit of 48 tests
EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tafazzin (TAZ)
Human Tafazzin (TAZ) ELISA Kit
DL-TAZ-Hu-96 1 kit of 96 tests
EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tafazzin (TAZ)
Human Tafazzin (TAZ) ELISA Kit
RD-TAZ-Hu-48Tests 48 Tests
EUR 521.00
Human Tafazzin (TAZ) ELISA Kit
RD-TAZ-Hu-96Tests 96 Tests
EUR 723.00
Human Tafazzin (TAZ) ELISA Kit
RDR-TAZ-Hu-48Tests 48 Tests
EUR 544.00
Human Tafazzin (TAZ) ELISA Kit
RDR-TAZ-Hu-96Tests 96 Tests
EUR 756.00
TAZ Antibody
AF4615 200ul
EUR 376.00
Description: TAZ Antibody detects endogenous levels of TAZ.
TAZ Antibody
AF4616 200ul
EUR 376.00
Description: TAZ Antibody detects endogenous levels of TAZ.
TAZ Antibody
1-CSB-PA023181EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAZ. Recognizes TAZ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
TAZ Antibody
CSB-PA113377-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TAZ. Recognizes TAZ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TAZ Antibody
CSB-PA113377-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TAZ. Recognizes TAZ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TAZ Antibody
1-CSB-PA050215
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TAZ. Recognizes TAZ from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000
TAZ antibody
20R-2743 50 ug
EUR 281.00
Description: Rabbit polyclonal TAZ antibody
TAZ Antibody
21634-100ul 100ul
EUR 252.00
TAZ Antibody
21634-50ul 50ul
EUR 187.00
TAZ Antibody
35176-100ul 100ul
EUR 252.00
TAZ Antibody
35176-50ul 50ul
EUR 187.00
TAZ antibody
70R-50455 100 ul
EUR 244.00
Description: Purified Polyclonal TAZ antibody
TAZ antibody
70R-TR026 100 ug
EUR 300.00
Description: Affinity purified Rabbit polyclonal TAZ antibody
TAZ siRNA
20-abx936145
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TAZ Antibody
DF4653 200ul
EUR 304.00
Description: TAZ Antibody detects endogenous levels of total TAZ.
TAZ Antibody
ABD4653 100 ug
EUR 438.00
Tafazzin (TAZ) Antibody
20-abx100206
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tafazzin (TAZ) Antibody
20-abx100207
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tafazzin (TAZ) Antibody
20-abx100208
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
TAZ Conjugated Antibody
C21634 100ul
EUR 397.00
TAZ Blocking Peptide
AF4615-BP 1mg
EUR 195.00
TAZ Blocking Peptide
AF4616-BP 1mg
EUR 195.00
TAZ cloning plasmid
CSB-CL023181HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 789
  • Sequence: atgcctctgcacgtgaagtggccgttccccgcggtgccgccgctcacctggaccctggccagcagcgtcgtcatgggcttggtgggcacctacagctgcttctggaccagtgagtgggcccaggccgaggcaggcccgcccgggtacccatgcccggccggagggatcctgaaact
  • Show more
Description: A cloning plasmid for the TAZ gene.
TAZ Polyclonal Antibody
A63540 100 µg
EUR 570.55
Description: fast delivery possible
Tafazzin (TAZ) Antibody
20-abx008659
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Tafazzin (TAZ) Antibody
20-abx015037
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Tafazzin (TAZ) Antibody
abx034111-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Tafazzin (TAZ) Antibody
abx034111-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
TAZ Blocking Peptide
20-abx063330
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Tafazzin (TAZ) Antibody
20-abx005405
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Tafazzin (TAZ) Antibody
abx331195-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.
Tafazzin (TAZ) Antibody
20-abx324080
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tafazzin (TAZ) Antibody
abx433340-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.
Tafazzin (TAZ) Antibody
abx238508-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.
Tafazzin (TAZ) Antibody
20-abx305497
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tafazzin (TAZ) Antibody
20-abx174710
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
TAZ Blocking Peptide
DF4653-BP 1mg
EUR 195.00
TAZ Rabbit pAb
A15806-100ul 100 ul
EUR 308.00
TAZ Rabbit pAb
A15806-200ul 200 ul
EUR 459.00
TAZ Rabbit pAb
A15806-20ul 20 ul
EUR 183.00
TAZ Rabbit pAb
A15806-50ul 50 ul
EUR 223.00
Anti-TAZ Antibody
A02672 100ul
EUR 397.00
Description: Rabbit Polyclonal TAZ Antibody. Validated in WB and tested in Human, Mouse, Rat.
TAZ Rabbit pAb
A8202-100ul 100 ul
EUR 308.00
TAZ Rabbit pAb
A8202-200ul 200 ul
EUR 459.00
TAZ Rabbit pAb
A8202-20ul 20 ul
EUR 183.00
TAZ Rabbit pAb
A8202-50ul 50 ul
EUR 223.00
anti- TAZ antibody
FNab08508 100µg
EUR 585.00
  • Recommended dilution: WB: 1:1000-1:4000
  • IP: 1:200-1:1000
  • IHC: 1:50-1:500
  • Immunogen: WW domain containing transcription regulator 1
  • Uniprot ID: Q16635
  • Gene ID: 25937
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against TAZ
Anti-TAZ antibody
PAab08508 100 ug
EUR 412.00
pCMV-SPORT6-TAZ
PVT12921 2 ug
EUR 391.00
Anti-TAZ antibody
STJ114589 100 µl
EUR 277.00
Description: This gene encodes a protein that is expressed at high levels in cardiac and skeletal muscle. Mutations in this gene have been associated with a number of clinical disorders including Barth syndrome, dilated cardiomyopathy (DCM), hypertrophic DCM, endocardial fibroelastosis, and left ventricular noncompaction (LVNC). Multiple transcript variants encoding different isoforms have been described. A long form and a short form of each of these isoforms is produced; the short form lacks a hydrophobic leader sequence and may exist as a cytoplasmic protein rather than being membrane-bound. Other alternatively spliced transcripts have been described but the full-length nature of all these transcripts is not known.
Anti-TAZ antibody
STJ114595 100 µl
EUR 277.00
Description: This gene encodes a protein that is expressed at high levels in cardiac and skeletal muscle. Mutations in this gene have been associated with a number of clinical disorders including Barth syndrome, dilated cardiomyopathy (DCM), hypertrophic DCM, endocardial fibroelastosis, and left ventricular noncompaction (LVNC). Multiple transcript variants encoding different isoforms have been described. A long form and a short form of each of these isoforms is produced; the short form lacks a hydrophobic leader sequence and may exist as a cytoplasmic protein rather than being membrane-bound. Other alternatively spliced transcripts have been described but the full-length nature of all these transcripts is not known.
Recombinant Tafazzin (TAZ)
4-RPE564Hu01
  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q16635
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.6kDa
  • Isoelectric Point: 9.2
Description: Recombinant Human Tafazzin expressed in: E.coli
Recombinant Tafazzin (TAZ)
4-RPE564Mu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: I7HJS2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Tafazzin expressed in: E.coli
Recombinant Tafazzin (TAZ)
4-RPE564Ra01
  • EUR 646.56
  • EUR 276.00
  • EUR 2149.60
  • EUR 783.20
  • EUR 1466.40
  • EUR 496.00
  • EUR 5224.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q4KLG6
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.1kDa
  • Isoelectric Point: 9
Description: Recombinant Rat Tafazzin expressed in: E.coli
Anti-TAZ antibody
STJ29242 100 µl
EUR 277.00
Description: This gene encodes a protein that is expressed at high levels in cardiac and skeletal muscle. Mutations in this gene have been associated with a number of clinical disorders including Barth syndrome, dilated cardiomyopathy (DCM), hypertrophic DCM, endocardial fibroelastosis, and left ventricular noncompaction (LVNC). Multiple transcript variants encoding different isoforms have been described. A long form and a short form of each of these isoforms is produced; the short form lacks a hydrophobic leader sequence and may exist as a cytoplasmic protein rather than being membrane-bound. Other alternatively spliced transcripts have been described but the full-length nature of all these transcripts is not known.
Anti-TAZ (3A12)
YF-MA15730 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Anti-TAZ (1B10)
YF-MA15731 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Anti-TAZ (1F11)
YF-MA15732 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Anti-TAZ (2B3)
YF-MA15733 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Anti-TAZ (1F9)
YF-MA15734 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Anti-TAZ (2G7)
YF-MA15735 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Anti-TAZ (3A11)
YF-MA15736 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Anti-TAZ (1A4)
YF-MA15737 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Anti-TAZ (3C10)
YF-MA15738 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Anti-TAZ (1E5)
YF-MA15739 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Anti-TAZ (1F1)
YF-MA11422 100 ug
EUR 363.00
Description: Mouse monoclonal to TAZ
Human Tafazzin (TAZ) Protein
20-abx069227
  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.