TAZ

Human Tafazzin (TAZ) ELISA Kit
DLR-TAZ-Hu-96T	DL Develop	96T	EUR 673
Should the Human Tafazzin (TAZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tafazzin (TAZ) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Tafazzin (TAZ) ELISA Kit
RD-TAZ-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Tafazzin (TAZ) ELISA Kit
RD-TAZ-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Tafazzin (TAZ) ELISA Kit
RDR-TAZ-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Tafazzin (TAZ) ELISA Kit
RDR-TAZ-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

TAZ antibody
20R-2743	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal TAZ antibody

TAZ Antibody
21634-100ul	SAB	100ul	EUR 252

TAZ Antibody
21634-50ul	SAB	50ul	EUR 187

TAZ Antibody
35176-100ul	SAB	100ul	EUR 252

TAZ Antibody
35176-50ul	SAB	50ul	EUR 187

TAZ Antibody
1-CSB-PA050215	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TAZ. Recognizes TAZ from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

TAZ Antibody
CSB-PA113377-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TAZ. Recognizes TAZ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TAZ Antibody
CSB-PA113377-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TAZ. Recognizes TAZ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TAZ Antibody
DF4653	Affbiotech	200ul	EUR 304
Description: TAZ Antibody detects endogenous levels of total TAZ.

TAZ antibody
70R-TR026	Fitzgerald	100 ug	EUR 300
Description: Affinity purified Rabbit polyclonal TAZ antibody

TAZ antibody
70R-50455	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal TAZ antibody

TAZ Antibody
AF4615	Affbiotech	200ul	EUR 376
Description: TAZ Antibody detects endogenous levels of TAZ.

TAZ Antibody
AF4616	Affbiotech	200ul	EUR 376
Description: TAZ Antibody detects endogenous levels of TAZ.

TAZ Antibody
1-CSB-PA023181EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TAZ. Recognizes TAZ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TAZ siRNA
20-abx936145	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TAZ Antibody
ABD4653	Lifescience Market	100 ug	EUR 438

TAZ Rabbit pAb
A15806-100ul	Abclonal	100 ul	EUR 308

TAZ Rabbit pAb
A15806-200ul	Abclonal	200 ul	EUR 459

TAZ Rabbit pAb
A15806-20ul	Abclonal	20 ul	EUR 183

TAZ Rabbit pAb
A15806-50ul	Abclonal	50 ul	EUR 223

TAZ Blocking Peptide
DF4653-BP	Affbiotech	1mg	EUR 195

Anti-TAZ Antibody
A02672	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal TAZ Antibody. Validated in WB and tested in Human, Mouse, Rat.

Tafazzin (TAZ) Antibody
20-abx008659	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Tafazzin (TAZ) Antibody
20-abx005405	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Tafazzin (TAZ) Antibody
20-abx015037	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Tafazzin (TAZ) Antibody
20-abx100206	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tafazzin (TAZ) Antibody
20-abx100207	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tafazzin (TAZ) Antibody
20-abx100208	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tafazzin (TAZ) Antibody
20-abx174710	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

TAZ Blocking Peptide
20-abx063330	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Tafazzin (TAZ) Antibody
abx034111-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tafazzin (TAZ) Antibody
abx034111-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tafazzin (TAZ) Antibody
abx238508-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

TAZ Blocking Peptide
AF4615-BP	Affbiotech	1mg	EUR 195

TAZ Blocking Peptide
AF4616-BP	Affbiotech	1mg	EUR 195

TAZ Conjugated Antibody
C21634	SAB	100ul	EUR 397

Tafazzin (TAZ) Antibody
abx331195-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Tafazzin (TAZ) Antibody
20-abx324080	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Tafazzin (TAZ) Antibody
abx433340-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Tafazzin (TAZ) Antibody
20-abx305497	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TAZ cloning plasmid
CSB-CL023181HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 789 Sequence: atgcctctgcacgtgaagtggccgttccccgcggtgccgccgctcacctggaccctggccagcagcgtcgtcatgggcttggtgggcacctacagctgcttctggaccagtgagtgggcccaggccgaggcaggcccgcccgggtacccatgcccggccggagggatcctgaaact Show more
Description: A cloning plasmid for the TAZ gene.

TAZ Rabbit pAb
A8202-100ul	Abclonal	100 ul	EUR 308

TAZ Rabbit pAb
A8202-200ul	Abclonal	200 ul	EUR 459

TAZ Rabbit pAb
A8202-20ul	Abclonal	20 ul	EUR 183

TAZ Rabbit pAb
A8202-50ul	Abclonal	50 ul	EUR 223

TAZ Polyclonal Antibody
A63540	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

anti- TAZ antibody
FNab08508	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:1000-1:4000 IP: 1:200-1:1000 IHC: 1:50-1:500 Immunogen: WW domain containing transcription regulator 1 Uniprot ID: Q16635 Gene ID: 25937 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against TAZ

Anti-TAZ antibody
PAab08508	Lifescience Market	100 ug	EUR 412

Recombinant Tafazzin (TAZ)
4-RPE564Hu01	Cloud-Clone	EUR 521.12 EUR 242.00 EUR 1679.20 EUR 626.40 EUR 1152.80 EUR 412.00 EUR 4048.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q16635 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.6kDa Isoelectric Point: 9.2
Description: Recombinant Human Tafazzin expressed in: E.coli

Recombinant Tafazzin (TAZ)
4-RPE564Mu01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: I7HJS2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.2kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Tafazzin expressed in: E.coli

Recombinant Tafazzin (TAZ)
4-RPE564Ra01	Cloud-Clone	EUR 646.56 EUR 276.00 EUR 2149.60 EUR 783.20 EUR 1466.40 EUR 496.00 EUR 5224.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q4KLG6 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 26.1kDa Isoelectric Point: 9
Description: Recombinant Rat Tafazzin expressed in: E.coli

pCMV-SPORT6-TAZ
PVT12921	Lifescience Market	2 ug	EUR 391

Anti-TAZ antibody
STJ114589	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is expressed at high levels in cardiac and skeletal muscle. Mutations in this gene have been associated with a number of clinical disorders including Barth syndrome, dilated cardiomyopathy (DCM), hypertrophic DCM, endocardial fibroelastosis, and left ventricular noncompaction (LVNC). Multiple transcript variants encoding different isoforms have been described. A long form and a short form of each of these isoforms is produced; the short form lacks a hydrophobic leader sequence and may exist as a cytoplasmic protein rather than being membrane-bound. Other alternatively spliced transcripts have been described but the full-length nature of all these transcripts is not known.

Anti-TAZ antibody
STJ114595	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is expressed at high levels in cardiac and skeletal muscle. Mutations in this gene have been associated with a number of clinical disorders including Barth syndrome, dilated cardiomyopathy (DCM), hypertrophic DCM, endocardial fibroelastosis, and left ventricular noncompaction (LVNC). Multiple transcript variants encoding different isoforms have been described. A long form and a short form of each of these isoforms is produced; the short form lacks a hydrophobic leader sequence and may exist as a cytoplasmic protein rather than being membrane-bound. Other alternatively spliced transcripts have been described but the full-length nature of all these transcripts is not known.

Anti-TAZ antibody
STJ29242	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is expressed at high levels in cardiac and skeletal muscle. Mutations in this gene have been associated with a number of clinical disorders including Barth syndrome, dilated cardiomyopathy (DCM), hypertrophic DCM, endocardial fibroelastosis, and left ventricular noncompaction (LVNC). Multiple transcript variants encoding different isoforms have been described. A long form and a short form of each of these isoforms is produced; the short form lacks a hydrophobic leader sequence and may exist as a cytoplasmic protein rather than being membrane-bound. Other alternatively spliced transcripts have been described but the full-length nature of all these transcripts is not known.

Anti-TAZ (1F1)
YF-MA11422	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ (3A12)
YF-MA15730	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ (1B10)
YF-MA15731	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ (1F11)
YF-MA15732	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ (2B3)
YF-MA15733	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ (1F9)
YF-MA15734	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ (2G7)
YF-MA15735	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ (3A11)
YF-MA15736	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ (1A4)
YF-MA15737	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ (3C10)
YF-MA15738	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ (1E5)
YF-MA15739	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TAZ

Anti-TAZ Antibody
A2028-100	Biovision	100 µl	EUR 399

Tafazzin / TAZ Polyclonal Antibody
27762-100ul	SAB	100ul	EUR 252

Tafazzin / TAZ Polyclonal Antibody
27762-50ul	SAB	50ul	EUR 187

Tafazzin / TAZ Polyclonal Antibody
27765-100ul	SAB	100ul	EUR 252