C3957-25 25 mg
EUR 605
Description: Tetrabromocinnamic Acid (TBCA) is a new class of specific protein kinase CK2 inhibitors [1]. Protein kinases have been involved in catalyzing the phosphorylation of serine, threonine and tyrosine residues in protein substrates that play dominant roles in controlling nearly all cellular functions.
C3957-5 5 mg
EUR 180
Description: Tetrabromocinnamic Acid (TBCA) is a new class of specific protein kinase CK2 inhibitors [1]. Protein kinases have been involved in catalyzing the phosphorylation of serine, threonine and tyrosine residues in protein substrates that play dominant roles in controlling nearly all cellular functions.
Tbca/ Rat Tbca ELISA Kit
ELI-29144r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBCA antibody
70R-20713 50 ul
EUR 435
Description: Rabbit polyclonal TBCA antibody
TBCA Antibody
42897-100ul 100ul
EUR 252
TBCA antibody
10R-1152 100 ul
EUR 316
Description: Mouse monoclonal TBCA antibody
TBCA protein
30R-1333 100 ug
EUR 305
Description: Purified recombinant Human TBCA protein
TBCA Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TBCA. Recognizes TBCA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
TBCA Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCA. Recognizes TBCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TBCA Conjugated Antibody
C42897 100ul
EUR 397
TBCA cloning plasmid
CSB-CL023225HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 327
  • Sequence: atggccgatcctcgcgtgagacagatcaagatcaagaccggcgtggtgaagcggttggtcaaagaaaaagtgatgtatgaaaaagaggcaaaacaacaagaagaaaagattgaaaaaatgagagctgaagacggtgaaaattatgacattaaaaagcaggcagagatcctacaaga
  • Show more
Description: A cloning plasmid for the TBCA gene.
anti- TBCA antibody
FNab08516 100µg
EUR 548.75
  • Immunogen: tubulin folding cofactor A
  • Uniprot ID: O75347
  • Gene ID: 6902
  • Research Area: Metabolism
Description: Antibody raised against TBCA
TBCA Polyclonal Antibody
A61250 100 µg
EUR 570.55
Description: Ask the seller for details
TBCA Rabbit pAb
A13050-100ul 100 ul
EUR 308
TBCA Rabbit pAb
A13050-200ul 200 ul
EUR 459
TBCA Rabbit pAb
A13050-20ul 20 ul
EUR 183
TBCA Rabbit pAb
A13050-50ul 50 ul
EUR 223
TBCA Rabbit pAb
A8808-100ul 100 ul
EUR 308
TBCA Rabbit pAb
A8808-200ul 200 ul
EUR 459
TBCA Rabbit pAb
A8808-20ul 20 ul Ask for price
TBCA Rabbit pAb
A8808-50ul 50 ul Ask for price
Anti-TBCA antibody
PAab08516 100 ug
EUR 386
Anti-TBCA antibody
STJ111426 100 µl
EUR 277
Description: The product of this gene is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. This gene encodes chaperonin cofactor A. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-TBCA antibody
STJ115017 100 µl
EUR 277
Description: The product of this gene is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. This gene encodes chaperonin cofactor A. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-TBCA (1D2)
YF-MA15740 100 ug
EUR 363
Description: Mouse monoclonal to TBCA
Polyclonal TBCA Antibody (Center)
AMM08121G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBCA (Center). This antibody is tested and proven to work in the following applications:
EF003468 96 Tests
EUR 689
Human TBCA shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TBCA shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat TBCA shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TBCA Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCA. Recognizes TBCA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TBCA Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCA. Recognizes TBCA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TBCA Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TBCA. Recognizes TBCA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TBCA Recombinant Protein (Human)
RP031030 100 ug Ask for price
TBCA Recombinant Protein (Rat)
RP232454 100 ug Ask for price
TBCA Recombinant Protein (Mouse)
RP177575 100 ug Ask for price
TBCA Polyclonal Antibody, Biotin Conjugated
A61251 100 µg
EUR 570.55
Description: The best epigenetics products
TBCA Polyclonal Antibody, FITC Conjugated
A61252 100 µg
EUR 570.55
Description: kits suitable for this type of research
TBCA Polyclonal Antibody, HRP Conjugated
A61253 100 µg
EUR 570.55
Description: fast delivery possible
Tbca ORF Vector (Mouse) (pORF)
ORF059193 1.0 ug DNA
EUR 506
TBCA ORF Vector (Human) (pORF)
ORF010344 1.0 ug DNA
EUR 95
Tbca ORF Vector (Rat) (pORF)
ORF077486 1.0 ug DNA
EUR 506
Tubulin Folding Cofactor A (TBCA) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor A (TBCA) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor A (TBCA) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tubulin Folding Cofactor A (TBCA) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tubulin Folding Cofactor A (TBCA) Antibody
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor A (TBCA) Protein
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor A (TBCA) Antibody
abx238516-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Tubulin Folding Cofactor A (TBCA) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TBCA sgRNA CRISPR Lentivector set (Human)
K2342101 3 x 1.0 ug
EUR 339
Tbca sgRNA CRISPR Lentivector set (Mouse)
K4721001 3 x 1.0 ug
EUR 339
Tbca sgRNA CRISPR Lentivector set (Rat)
K6297401 3 x 1.0 ug
EUR 339
Recombinant Tubulin Folding Cofactor A (TBCA)
  • EUR 420.77
  • EUR 215.00
  • EUR 1302.88
  • EUR 500.96
  • EUR 901.92
  • EUR 344.00
  • EUR 3107.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O75347
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Tubulin Folding Cofactor A expressed in: E.coli
Recombinant Tubulin Folding Cofactor A (TBCA)
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P48428
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Tubulin Folding Cofactor A expressed in: E.coli
Human Tubulin Folding Cofactor A (TBCA) Protein
  • EUR 592.00
  • EUR 258.00
  • EUR 1762.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Tubulin Folding Cofactor A (TBCA) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tubulin Folding Cofactor A (TBCA) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor A (TBCA) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor A (TBCA) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TBCA sgRNA CRISPR Lentivector (Human) (Target 1)
K2342102 1.0 ug DNA
EUR 154
TBCA sgRNA CRISPR Lentivector (Human) (Target 2)
K2342103 1.0 ug DNA
EUR 154
TBCA sgRNA CRISPR Lentivector (Human) (Target 3)
K2342104 1.0 ug DNA
EUR 154
Tbca sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4721002 1.0 ug DNA
EUR 154
Tbca sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4721003 1.0 ug DNA
EUR 154
Tbca sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4721004 1.0 ug DNA
EUR 154
Tbca sgRNA CRISPR Lentivector (Rat) (Target 1)
K6297402 1.0 ug DNA
EUR 154
Tbca sgRNA CRISPR Lentivector (Rat) (Target 2)
K6297403 1.0 ug DNA
EUR 154
Tbca sgRNA CRISPR Lentivector (Rat) (Target 3)
K6297404 1.0 ug DNA
EUR 154
TBCA Protein Vector (Human) (pPB-C-His)
PV041373 500 ng
EUR 329
TBCA Protein Vector (Human) (pPB-N-His)
PV041374 500 ng
EUR 329
TBCA Protein Vector (Human) (pPM-C-HA)
PV041375 500 ng
EUR 329