TIMM17A

TIMM17A Antibody
1-CSB-PA023550GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TIMM17A. Recognizes TIMM17A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
TIMM17A Antibody
42782-100ul 100ul
EUR 252.00
TIMM17A antibody
38927-100ul 100ul
EUR 252.00
TIMM17A antibody
70R-20828 50 ul
EUR 435.00
Description: Rabbit polyclonal TIMM17A antibody
TIMM17A siRNA
20-abx905578
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TIMM17A siRNA
20-abx936796
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TIMM17A siRNA
20-abx936797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TIMM17A Antibody
1-CSB-PA860770ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TIMM17A. Recognizes TIMM17A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TIMM17A Antibody
DF12774 200ul
EUR 304.00
Description: TIMM17A Antibody detects endogenous levels of TIMM17A.
TIMM17A Conjugated Antibody
C38927 100ul
EUR 397.00
TIMM17A Conjugated Antibody
C42782 100ul
EUR 397.00
TIMM17A cloning plasmid
CSB-CL860770HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 516
  • Sequence: atggaggagtacgcgcgagagccttgcccatggcgaattgtggatgactgtggtggggcctttacgatgggtaccattggtggtggtatctttcaagcaatcaaaggttttcgcaattctccagtgggagtaaaccacagactacgagggagtttgacagctattaaaaccagggc
  • Show more
Description: A cloning plasmid for the TIMM17A gene.
TIMM17A Rabbit pAb
A6449-100ul 100 ul
EUR 308.00
TIMM17A Rabbit pAb
A6449-200ul 200 ul
EUR 459.00
TIMM17A Rabbit pAb
A6449-20ul 20 ul
EUR 183.00
TIMM17A Rabbit pAb
A6449-50ul 50 ul
EUR 223.00
TIMM17A Blocking Peptide
DF12774-BP 1mg
EUR 195.00
TIMM17A Rabbit pAb
A13578-100ul 100 ul
EUR 308.00
TIMM17A Rabbit pAb
A13578-200ul 200 ul
EUR 459.00
TIMM17A Rabbit pAb
A13578-20ul 20 ul
EUR 183.00
TIMM17A Rabbit pAb
A13578-50ul 50 ul
EUR 223.00
Anti-TIMM17A Antibody
A1911-100
EUR 403.00
Anti-TIMM17A Antibody
A12168-1 100ug/vial
EUR 334.00
anti- TIMM17A antibody
FNab08697 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: translocase of inner mitochondrial membrane 17 homolog A (yeast)
  • Uniprot ID: Q99595
  • Gene ID: 10440
  • Research Area: Signal Transduction, Metabolism, Cancer
Description: Antibody raised against TIMM17A
Anti-TIMM17A antibody
PAab08697 100 ug
EUR 386.00
Anti-TIMM17A antibody
STJ115539 100 µl
EUR 277.00
Anti-TIMM17A antibody
STJ28532 100 µl
EUR 277.00
Anti-TIMM17A antibody
STJ11100793 100 µl
EUR 413.00
Anti-TIMM17A antibody
STJ11100794 100 µl
EUR 413.00
Rat TIMM17A shRNA Plasmid
20-abx985835
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TIMM17A shRNA Plasmid
20-abx957082
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TIMM17A shRNA Plasmid
20-abx973117
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Timm17a ELISA KIT
ELI-40006m 96 Tests
EUR 865.00
Human TIMM17A ELISA KIT
ELI-17310h 96 Tests
EUR 824.00
TIMM17A ELISA KIT|Human
EF003611 96 Tests
EUR 689.00
TIMM17A Recombinant Protein (Human)
RP031570 100 ug Ask for price
TIMM17A Recombinant Protein (Mouse)
RP178769 100 ug Ask for price
TIMM17A Recombinant Protein (Rat)
RP233141 100 ug Ask for price
[KO Validated] TIMM17A Rabbit pAb
A19917-100ul 100 ul
EUR 410.00
[KO Validated] TIMM17A Rabbit pAb
A19917-200ul 200 ul
EUR 571.00
[KO Validated] TIMM17A Rabbit pAb
A19917-20ul 20 ul
EUR 221.00
[KO Validated] TIMM17A Rabbit pAb
A19917-50ul 50 ul
EUR 287.00
[KO Validated] TIMM17A Rabbit pAb
A19918-100ul 100 ul
EUR 410.00
[KO Validated] TIMM17A Rabbit pAb
A19918-200ul 200 ul
EUR 571.00
[KO Validated] TIMM17A Rabbit pAb
A19918-20ul 20 ul
EUR 221.00
[KO Validated] TIMM17A Rabbit pAb
A19918-50ul 50 ul
EUR 287.00
TIMM17A ORF Vector (Human) (pORF)
ORF010524 1.0 ug DNA
EUR 95.00
Timm17a ORF Vector (Rat) (pORF)
ORF077715 1.0 ug DNA
EUR 506.00
Timm17a ORF Vector (Mouse) (pORF)
ORF059591 1.0 ug DNA
EUR 506.00
[One Step] TIMM17A Antibody Kit
RK05715 50 ul
EUR 240.00
TIMM17A sgRNA CRISPR Lentivector set (Human)
K2375201 3 x 1.0 ug
EUR 339.00
Timm17a sgRNA CRISPR Lentivector set (Rat)
K6876401 3 x 1.0 ug
EUR 339.00
Timm17a sgRNA CRISPR Lentivector set (Mouse)
K4947801 3 x 1.0 ug
EUR 339.00
TIMM17A sgRNA CRISPR Lentivector (Human) (Target 1)
K2375202 1.0 ug DNA
EUR 154.00
TIMM17A sgRNA CRISPR Lentivector (Human) (Target 2)
K2375203 1.0 ug DNA
EUR 154.00
TIMM17A sgRNA CRISPR Lentivector (Human) (Target 3)
K2375204 1.0 ug DNA
EUR 154.00
Timm17a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6876402 1.0 ug DNA
EUR 154.00
Timm17a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6876403 1.0 ug DNA
EUR 154.00
Timm17a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6876404 1.0 ug DNA
EUR 154.00
Timm17a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4947802 1.0 ug DNA
EUR 154.00
Timm17a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4947803 1.0 ug DNA
EUR 154.00
Timm17a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4947804 1.0 ug DNA
EUR 154.00
TIMM17A Protein Vector (Rat) (pPB-C-His)
PV310858 500 ng
EUR 603.00
TIMM17A Protein Vector (Rat) (pPB-N-His)
PV310859 500 ng
EUR 603.00
TIMM17A Protein Vector (Rat) (pPM-C-HA)
PV310860 500 ng
EUR 603.00
TIMM17A Protein Vector (Rat) (pPM-C-His)
PV310861 500 ng
EUR 603.00
TIMM17A Protein Vector (Mouse) (pPB-C-His)
PV238362 500 ng
EUR 603.00
TIMM17A Protein Vector (Mouse) (pPB-N-His)
PV238363 500 ng
EUR 603.00
TIMM17A Protein Vector (Mouse) (pPM-C-HA)
PV238364 500 ng
EUR 603.00
TIMM17A Protein Vector (Mouse) (pPM-C-His)
PV238365 500 ng
EUR 603.00
TIMM17A Protein Vector (Human) (pPB-C-His)
PV042093 500 ng
EUR 329.00
TIMM17A Protein Vector (Human) (pPB-N-His)
PV042094 500 ng
EUR 329.00
TIMM17A Protein Vector (Human) (pPM-C-HA)
PV042095 500 ng
EUR 329.00
TIMM17A Protein Vector (Human) (pPM-C-His)
PV042096 500 ng
EUR 329.00
Recombinant Human TIMM17A Protein, GST, E.coli-100ug
QP6791-ec-100ug 100ug
EUR 571.00