TIMM17A

TIMM17A siRNA
20-abx905578	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TIMM17A siRNA
20-abx936796	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TIMM17A siRNA
20-abx936797	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TIMM17A antibody
70R-20828	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TIMM17A antibody

TIMM17A antibody
38927-100ul	SAB	100ul	EUR 252

TIMM17A Antibody
42782-100ul	SAB	100ul	EUR 252

TIMM17A Antibody
DF12774	Affbiotech	200ul	EUR 304
Description: TIMM17A Antibody detects endogenous levels of TIMM17A.

TIMM17A Antibody
1-CSB-PA860770ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TIMM17A. Recognizes TIMM17A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TIMM17A Antibody
1-CSB-PA023550GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TIMM17A. Recognizes TIMM17A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TIMM17A Conjugated Antibody
C38927	SAB	100ul	EUR 397

TIMM17A Conjugated Antibody
C42782	SAB	100ul	EUR 397

anti- TIMM17A antibody
FNab08697	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: translocase of inner mitochondrial membrane 17 homolog A (yeast) Uniprot ID: Q99595 Gene ID: 10440 Research Area: Signal Transduction, Metabolism, Cancer
Description: Antibody raised against TIMM17A

Anti-TIMM17A Antibody
A12168-1	BosterBio	100ug/vial	EUR 334

TIMM17A Rabbit pAb
A13578-100ul	Abclonal	100 ul	EUR 308

TIMM17A Rabbit pAb
A13578-200ul	Abclonal	200 ul	EUR 459

TIMM17A Rabbit pAb
A13578-20ul	Abclonal	20 ul	EUR 183

TIMM17A Rabbit pAb
A13578-50ul	Abclonal	50 ul	EUR 223

Anti-TIMM17A Antibody
A1911-100	Biovision		EUR 403

TIMM17A Rabbit pAb
A6449-100ul	Abclonal	100 ul	EUR 308

TIMM17A Rabbit pAb
A6449-200ul	Abclonal	200 ul	EUR 459

TIMM17A Rabbit pAb
A6449-20ul	Abclonal	20 ul	EUR 183

TIMM17A Rabbit pAb
A6449-50ul	Abclonal	50 ul	EUR 223

TIMM17A cloning plasmid
CSB-CL860770HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 516 Sequence: atggaggagtacgcgcgagagccttgcccatggcgaattgtggatgactgtggtggggcctttacgatgggtaccattggtggtggtatctttcaagcaatcaaaggttttcgcaattctccagtgggagtaaaccacagactacgagggagtttgacagctattaaaaccagggc Show more
Description: A cloning plasmid for the TIMM17A gene.

TIMM17A Blocking Peptide
DF12774-BP	Affbiotech	1mg	EUR 195

Anti-TIMM17A antibody
PAab08697	Lifescience Market	100 ug	EUR 386

Anti-TIMM17A antibody
STJ28532	St John's Laboratory	100 µl	EUR 277

Anti-TIMM17A antibody
STJ11100793	St John's Laboratory	100 µl	EUR 413

Anti-TIMM17A antibody
STJ11100794	St John's Laboratory	100 µl	EUR 413

Anti-TIMM17A antibody
STJ115539	St John's Laboratory	100 µl	EUR 277

Rat TIMM17A shRNA Plasmid
20-abx985835	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TIMM17A ELISA KIT
ELI-17310h	Lifescience Market	96 Tests	EUR 824

TIMM17A ELISA KIT|Human
EF003611	Lifescience Market	96 Tests	EUR 689

Mouse Timm17a ELISA KIT
ELI-40006m	Lifescience Market	96 Tests	EUR 865

Human TIMM17A shRNA Plasmid
20-abx957082	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TIMM17A shRNA Plasmid
20-abx973117	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TIMM17A Recombinant Protein (Human)
RP031570	ABM	100 ug	Ask for price

TIMM17A Recombinant Protein (Rat)
RP233141	ABM	100 ug	Ask for price

TIMM17A Recombinant Protein (Mouse)
RP178769	ABM	100 ug	Ask for price

[KO Validated] TIMM17A Rabbit pAb
A19917-100ul	Abclonal	100 ul	EUR 410

[KO Validated] TIMM17A Rabbit pAb
A19917-200ul	Abclonal	200 ul	EUR 571

[KO Validated] TIMM17A Rabbit pAb
A19917-20ul	Abclonal	20 ul	EUR 221

[KO Validated] TIMM17A Rabbit pAb
A19917-50ul	Abclonal	50 ul	EUR 287

[KO Validated] TIMM17A Rabbit pAb
A19918-100ul	Abclonal	100 ul	EUR 410

[KO Validated] TIMM17A Rabbit pAb
A19918-200ul	Abclonal	200 ul	EUR 571

[KO Validated] TIMM17A Rabbit pAb
A19918-20ul	Abclonal	20 ul	EUR 221

[KO Validated] TIMM17A Rabbit pAb
A19918-50ul	Abclonal	50 ul	EUR 287

Timm17a ORF Vector (Mouse) (pORF)
ORF059591	ABM	1.0 ug DNA	EUR 506

TIMM17A ORF Vector (Human) (pORF)
ORF010524	ABM	1.0 ug DNA	EUR 95

Timm17a ORF Vector (Rat) (pORF)
ORF077715	ABM	1.0 ug DNA	EUR 506

[One Step] TIMM17A Antibody Kit
RK05715	Abclonal	50 ul	EUR 240

TIMM17A sgRNA CRISPR Lentivector set (Human)
K2375201	ABM	3 x 1.0 ug	EUR 339

Timm17a sgRNA CRISPR Lentivector set (Mouse)
K4947801	ABM	3 x 1.0 ug	EUR 339

Timm17a sgRNA CRISPR Lentivector set (Rat)
K6876401	ABM	3 x 1.0 ug	EUR 339

TIMM17A sgRNA CRISPR Lentivector (Human) (Target 1)
K2375202	ABM	1.0 ug DNA	EUR 154

TIMM17A sgRNA CRISPR Lentivector (Human) (Target 2)
K2375203	ABM	1.0 ug DNA	EUR 154

TIMM17A sgRNA CRISPR Lentivector (Human) (Target 3)
K2375204	ABM	1.0 ug DNA	EUR 154

Timm17a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4947802	ABM	1.0 ug DNA	EUR 154

Timm17a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4947803	ABM	1.0 ug DNA	EUR 154

Timm17a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4947804	ABM	1.0 ug DNA	EUR 154

Timm17a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6876402	ABM	1.0 ug DNA	EUR 154

Timm17a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6876403	ABM	1.0 ug DNA	EUR 154

Timm17a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6876404	ABM	1.0 ug DNA	EUR 154

TIMM17A Protein Vector (Human) (pPB-C-His)
PV042093	ABM	500 ng	EUR 329

TIMM17A Protein Vector (Human) (pPB-N-His)
PV042094	ABM	500 ng	EUR 329

TIMM17A Protein Vector (Human) (pPM-C-HA)
PV042095	ABM	500 ng	EUR 329

TIMM17A Protein Vector (Human) (pPM-C-His)
PV042096	ABM	500 ng	EUR 329

Recombinant Human TIMM17A Protein, GST, E.coli-100ug
QP6791-ec-100ug	EnQuireBio	100ug	EUR 571

Recombinant Human TIMM17A Protein, GST, E.coli-10ug
QP6791-ec-10ug	EnQuireBio	10ug	EUR 272

Recombinant Human TIMM17A Protein, GST, E.coli-1mg
QP6791-ec-1mg	EnQuireBio	1mg	EUR 2303

Recombinant Human TIMM17A Protein, GST, E.coli-200ug
QP6791-ec-200ug	EnQuireBio	200ug	EUR 898

Recombinant Human TIMM17A Protein, GST, E.coli-500ug
QP6791-ec-500ug	EnQuireBio	500ug	EUR 1514

Recombinant Human TIMM17A Protein, GST, E.coli-50ug
QP6791-ec-50ug	EnQuireBio	50ug	EUR 362

TIMM17A Protein Vector (Rat) (pPB-C-His)
PV310858	ABM	500 ng	EUR 603

TIMM17A Protein Vector (Rat) (pPB-N-His)
PV310859	ABM	500 ng	EUR 603

TIMM17A Protein Vector (Rat) (pPM-C-HA)
PV310860	ABM	500 ng	EUR 603