TMEM115

TMEM115 Antibody
1-CSB-PA023683LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM115. Recognizes TMEM115 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TMEM115 siRNA
20-abx937038	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMEM115 siRNA
20-abx937039	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMEM115 Blocking Peptide
33R-5190	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM115 antibody, catalog no. 70R-7397

TMEM115 Antibody (HRP)
20-abx305577	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TMEM115 Antibody (FITC)
20-abx305578	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TMEM115 Antibody (Biotin)
20-abx305579	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TMEM115 cloning plasmid
CSB-CL023683HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1056 Sequence: atgcaacgtgccctgccaggcgcccgccagcacttgggggccattctggccagcgccagcgtggtggtgaaggctctgtgtgcggcggtactattcctctacctgctctccttcgccgtggacacaggctgcctggcggtcaccccgggctacctctttcctcccaacttctgga Show more
Description: A cloning plasmid for the TMEM115 gene.

TMEM115 Polyclonal Antibody
A61362	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Mouse TMEM115 shRNA Plasmid
20-abx974745	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TMEM115 Antibody, HRP conjugated
1-CSB-PA023683LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM115. Recognizes TMEM115 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TMEM115 Antibody, FITC conjugated
1-CSB-PA023683LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM115. Recognizes TMEM115 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TMEM115 Antibody, Biotin conjugated
1-CSB-PA023683LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM115. Recognizes TMEM115 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human TMEM115 shRNA Plasmid
20-abx957568	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TMEM115 Recombinant Protein (Rat)
RP233456	ABM	100 ug	Ask for price

TMEM115 Recombinant Protein (Human)
RP031876	ABM	100 ug	Ask for price

TMEM115 Recombinant Protein (Mouse)
RP179228	ABM	100 ug	Ask for price

Polyclonal TMEM115 Antibody (C-Term)
AMM08234G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMEM115 (C-Term). This antibody is tested and proven to work in the following applications:

Transmembrane Protein 115 (TMEM115) Antibody
20-abx301963	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TMEM115 Polyclonal Antibody, Biotin Conjugated
A61363	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

TMEM115 Polyclonal Antibody, FITC Conjugated
A61364	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

TMEM115 Polyclonal Antibody, HRP Conjugated
A61365	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Tmem115 ORF Vector (Rat) (pORF)
ORF077820	ABM	1.0 ug DNA	EUR 506

TMEM115 ORF Vector (Human) (pORF)
ORF010626	ABM	1.0 ug DNA	EUR 95

Tmem115 ORF Vector (Mouse) (pORF)
ORF059744	ABM	1.0 ug DNA	EUR 506

Polyclonal TMEM115 antibody - N-terminal region
AMM08235G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMEM115 - N-terminal region. This antibody is tested and proven to work in the following applications:

Tmem115 sgRNA CRISPR Lentivector set (Rat)
K6613101	ABM	3 x 1.0 ug	EUR 339

Tmem115 sgRNA CRISPR Lentivector set (Mouse)
K3299501	ABM	3 x 1.0 ug	EUR 339

TMEM115 sgRNA CRISPR Lentivector set (Human)
K2397001	ABM	3 x 1.0 ug	EUR 339

Mouse Transmembrane protein 115, Tmem115 ELISA KIT
ELI-29382m	Lifescience Market	96 Tests	EUR 865

Human Transmembrane protein 115, TMEM115 ELISA KIT
ELI-51903h	Lifescience Market	96 Tests	EUR 824

Bovine Transmembrane protein 115, TMEM115 ELISA KIT
ELI-40029b	Lifescience Market	96 Tests	EUR 928

Tmem115 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6613102	ABM	1.0 ug DNA	EUR 154

Tmem115 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6613103	ABM	1.0 ug DNA	EUR 154

Tmem115 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6613104	ABM	1.0 ug DNA	EUR 154

Tmem115 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3299502	ABM	1.0 ug DNA	EUR 154

Tmem115 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3299503	ABM	1.0 ug DNA	EUR 154

Tmem115 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3299504	ABM	1.0 ug DNA	EUR 154

TMEM115 sgRNA CRISPR Lentivector (Human) (Target 1)
K2397002	ABM	1.0 ug DNA	EUR 154

TMEM115 sgRNA CRISPR Lentivector (Human) (Target 2)
K2397003	ABM	1.0 ug DNA	EUR 154

TMEM115 sgRNA CRISPR Lentivector (Human) (Target 3)
K2397004	ABM	1.0 ug DNA	EUR 154

TMEM115 Protein Vector (Rat) (pPB-C-His)
PV311278	ABM	500 ng	EUR 603

TMEM115 Protein Vector (Rat) (pPB-N-His)
PV311279	ABM	500 ng	EUR 603

TMEM115 Protein Vector (Rat) (pPM-C-HA)
PV311280	ABM	500 ng	EUR 603

TMEM115 Protein Vector (Rat) (pPM-C-His)
PV311281	ABM	500 ng	EUR 603

TMEM115 Protein Vector (Mouse) (pPB-C-His)
PV238974	ABM	500 ng	EUR 603

TMEM115 Protein Vector (Mouse) (pPB-N-His)
PV238975	ABM	500 ng	EUR 603

TMEM115 Protein Vector (Mouse) (pPM-C-HA)
PV238976	ABM	500 ng	EUR 603

TMEM115 Protein Vector (Mouse) (pPM-C-His)
PV238977	ABM	500 ng	EUR 603

TMEM115 Protein Vector (Human) (pPB-C-His)
PV042501	ABM	500 ng	EUR 329

TMEM115 Protein Vector (Human) (pPB-N-His)
PV042502	ABM	500 ng	EUR 329

TMEM115 Protein Vector (Human) (pPM-C-HA)
PV042503	ABM	500 ng	EUR 329

TMEM115 Protein Vector (Human) (pPM-C-His)
PV042504	ABM	500 ng	EUR 329

Tmem115 3'UTR Luciferase Stable Cell Line
TU120622	ABM	1.0 ml	Ask for price

Tmem115 3'UTR GFP Stable Cell Line
TU170622	ABM	1.0 ml	Ask for price

Tmem115 3'UTR Luciferase Stable Cell Line
TU222009	ABM	1.0 ml	Ask for price

TMEM115 3'UTR GFP Stable Cell Line
TU075819	ABM	1.0 ml	EUR 1394

Tmem115 3'UTR GFP Stable Cell Line
TU272009	ABM	1.0 ml	Ask for price

TMEM115 3'UTR Luciferase Stable Cell Line
TU025819	ABM	1.0 ml	EUR 1394

TMEM115 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV620863	ABM	1.0 ug DNA	EUR 682

TMEM115 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV620867	ABM	1.0 ug DNA	EUR 682

TMEM115 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV620868	ABM	1.0 ug DNA	EUR 682

Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6613105	ABM	3 x 1.0 ug	EUR 376

Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3299505	ABM	3 x 1.0 ug	EUR 376

TMEM115 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2397005	ABM	3 x 1.0 ug	EUR 376

TMEM115 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV620864	ABM	1.0 ug DNA	EUR 682

TMEM115 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV620865	ABM	1.0 ug DNA	EUR 740

TMEM115 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV620866	ABM	1.0 ug DNA	EUR 740

Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6613106	ABM	1.0 ug DNA	EUR 167

Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6613107	ABM	1.0 ug DNA	EUR 167

Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6613108	ABM	1.0 ug DNA	EUR 167

Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3299506	ABM	1.0 ug DNA	EUR 167

Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3299507	ABM	1.0 ug DNA	EUR 167

Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3299508	ABM	1.0 ug DNA	EUR 167

TMEM115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2397006	ABM	1.0 ug DNA	EUR 167