TMEM115 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM115. Recognizes TMEM115 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TMEM115 Blocking Peptide
33R-5190 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMEM115 antibody, catalog no. 70R-7397
TMEM115 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TMEM115 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TMEM115 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TMEM115 cloning plasmid
CSB-CL023683HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1056
  • Sequence: atgcaacgtgccctgccaggcgcccgccagcacttgggggccattctggccagcgccagcgtggtggtgaaggctctgtgtgcggcggtactattcctctacctgctctccttcgccgtggacacaggctgcctggcggtcaccccgggctacctctttcctcccaacttctgga
  • Show more
Description: A cloning plasmid for the TMEM115 gene.
TMEM115 Polyclonal Antibody
A61362 100 µg
EUR 570.55
Description: The best epigenetics products
Mouse TMEM115 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TMEM115 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM115. Recognizes TMEM115 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TMEM115 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM115. Recognizes TMEM115 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TMEM115 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM115. Recognizes TMEM115 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human TMEM115 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TMEM115 Recombinant Protein (Rat)
RP233456 100 ug Ask for price
TMEM115 Recombinant Protein (Human)
RP031876 100 ug Ask for price
TMEM115 Recombinant Protein (Mouse)
RP179228 100 ug Ask for price
Polyclonal TMEM115 Antibody (C-Term)
AMM08234G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMEM115 (C-Term). This antibody is tested and proven to work in the following applications:
Transmembrane Protein 115 (TMEM115) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TMEM115 Polyclonal Antibody, Biotin Conjugated
A61363 100 µg
EUR 570.55
Description: kits suitable for this type of research
TMEM115 Polyclonal Antibody, FITC Conjugated
A61364 100 µg
EUR 570.55
Description: fast delivery possible
TMEM115 Polyclonal Antibody, HRP Conjugated
A61365 100 µg
EUR 570.55
Description: reagents widely cited
Tmem115 ORF Vector (Rat) (pORF)
ORF077820 1.0 ug DNA
EUR 506
TMEM115 ORF Vector (Human) (pORF)
ORF010626 1.0 ug DNA
EUR 95
Tmem115 ORF Vector (Mouse) (pORF)
ORF059744 1.0 ug DNA
EUR 506
Polyclonal TMEM115 antibody - N-terminal region
AMM08235G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMEM115 - N-terminal region. This antibody is tested and proven to work in the following applications:
Tmem115 sgRNA CRISPR Lentivector set (Rat)
K6613101 3 x 1.0 ug
EUR 339
Tmem115 sgRNA CRISPR Lentivector set (Mouse)
K3299501 3 x 1.0 ug
EUR 339
TMEM115 sgRNA CRISPR Lentivector set (Human)
K2397001 3 x 1.0 ug
EUR 339
Mouse Transmembrane protein 115, Tmem115 ELISA KIT
ELI-29382m 96 Tests
EUR 865
Human Transmembrane protein 115, TMEM115 ELISA KIT
ELI-51903h 96 Tests
EUR 824
Bovine Transmembrane protein 115, TMEM115 ELISA KIT
ELI-40029b 96 Tests
EUR 928
Tmem115 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6613102 1.0 ug DNA
EUR 154
Tmem115 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6613103 1.0 ug DNA
EUR 154
Tmem115 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6613104 1.0 ug DNA
EUR 154
Tmem115 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3299502 1.0 ug DNA
EUR 154
Tmem115 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3299503 1.0 ug DNA
EUR 154
Tmem115 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3299504 1.0 ug DNA
EUR 154
TMEM115 sgRNA CRISPR Lentivector (Human) (Target 1)
K2397002 1.0 ug DNA
EUR 154
TMEM115 sgRNA CRISPR Lentivector (Human) (Target 2)
K2397003 1.0 ug DNA
EUR 154
TMEM115 sgRNA CRISPR Lentivector (Human) (Target 3)
K2397004 1.0 ug DNA
EUR 154
TMEM115 Protein Vector (Rat) (pPB-C-His)
PV311278 500 ng
EUR 603
TMEM115 Protein Vector (Rat) (pPB-N-His)
PV311279 500 ng
EUR 603
TMEM115 Protein Vector (Rat) (pPM-C-HA)
PV311280 500 ng
EUR 603
TMEM115 Protein Vector (Rat) (pPM-C-His)
PV311281 500 ng
EUR 603
TMEM115 Protein Vector (Mouse) (pPB-C-His)
PV238974 500 ng
EUR 603
TMEM115 Protein Vector (Mouse) (pPB-N-His)
PV238975 500 ng
EUR 603
TMEM115 Protein Vector (Mouse) (pPM-C-HA)
PV238976 500 ng
EUR 603
TMEM115 Protein Vector (Mouse) (pPM-C-His)
PV238977 500 ng
EUR 603
TMEM115 Protein Vector (Human) (pPB-C-His)
PV042501 500 ng
EUR 329
TMEM115 Protein Vector (Human) (pPB-N-His)
PV042502 500 ng
EUR 329
TMEM115 Protein Vector (Human) (pPM-C-HA)
PV042503 500 ng
EUR 329
TMEM115 Protein Vector (Human) (pPM-C-His)
PV042504 500 ng
EUR 329
Tmem115 3'UTR Luciferase Stable Cell Line
TU120622 1.0 ml Ask for price
Tmem115 3'UTR GFP Stable Cell Line
TU170622 1.0 ml Ask for price
Tmem115 3'UTR Luciferase Stable Cell Line
TU222009 1.0 ml Ask for price
TMEM115 3'UTR GFP Stable Cell Line
TU075819 1.0 ml
EUR 1394
Tmem115 3'UTR GFP Stable Cell Line
TU272009 1.0 ml Ask for price
TMEM115 3'UTR Luciferase Stable Cell Line
TU025819 1.0 ml
EUR 1394
TMEM115 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV620863 1.0 ug DNA
EUR 682
TMEM115 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV620867 1.0 ug DNA
EUR 682
TMEM115 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV620868 1.0 ug DNA
EUR 682
Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6613105 3 x 1.0 ug
EUR 376
Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3299505 3 x 1.0 ug
EUR 376
TMEM115 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2397005 3 x 1.0 ug
EUR 376
TMEM115 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV620864 1.0 ug DNA
EUR 682
TMEM115 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV620865 1.0 ug DNA
EUR 740
TMEM115 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV620866 1.0 ug DNA
EUR 740
Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6613106 1.0 ug DNA
EUR 167
Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6613107 1.0 ug DNA
EUR 167
Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6613108 1.0 ug DNA
EUR 167
Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3299506 1.0 ug DNA
EUR 167
Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3299507 1.0 ug DNA
EUR 167
Tmem115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3299508 1.0 ug DNA
EUR 167
TMEM115 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2397006 1.0 ug DNA
EUR 167