TOMM7

TOMM7 siRNA
20-abx937743	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TOMM7 Rabbit pAb
A17711-200ul	Abclonal	200 ul	EUR 459.00

TOMM7 Rabbit pAb
A17711-50ul	Abclonal	50 ul	EUR 223.00

TOMM7 Rabbit pAb
A17711-100ul	Abclonal	100 ul	EUR 308.00

TOMM7 Rabbit pAb
A17711-20ul	Abclonal	20 ul	EUR 183.00

TOMM7 Polyclonal Antibody
30141-100ul	SAB	100ul	EUR 252.00

TOMM7 Polyclonal Antibody
30141-50ul	SAB	50ul	EUR 187.00

TOMM7 cloning plasmid
CSB-CL889171HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 168 Sequence: atggtgaagctgagcaaagaggccaagcagagactacagcagctcttcaaggggagccagtttgccattcgctggggctttatccctcttgtgatttacctgggatttaagaggggtgcagatcccggaatgcctgaaccaactgttttgagcctactttggggataa
Description: A cloning plasmid for the TOMM7 gene.

Anti-TOMM7 antibody
PAab08864	Lifescience Market	100 ug	EUR 386.00

anti- TOMM7 antibody
FNab08864	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: translocase of outer mitochondrial membrane 7 homolog(yeast) Uniprot ID: Q9P0U1 Gene ID: 54543 Research Area: Signal Transduction
Description: Antibody raised against TOMM7

Anti-TOMM7 antibody
STJ119752	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a subunit of the translocase of the outer mitochondrial membrane. The encoded protein regulates the assembly and stability of the translocase complex. [provided by RefSeq, Oct 2012]

Anti-TOMM7 Antibody
STJ503354	St John's Laboratory	100 µg	EUR 476.00

Human TOMM7 shRNA Plasmid
20-abx960125	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TOMM7 shRNA Plasmid
20-abx975446	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TOMM7 Polyclonal Conjugated Antibody
C30141	SAB	100ul	EUR 397.00

Mouse Tomm7 ELISA KIT
ELI-17140m	Lifescience Market	96 Tests	EUR 865.00

TOMM7 ELISA KIT|Human
EF003745	Lifescience Market	96 Tests	EUR 689.00

Human TOMM7 ELISA KIT
ELI-40014h	Lifescience Market	96 Tests	EUR 824.00

Bovine TOMM7 ELISA KIT
ELI-23057b	Lifescience Market	96 Tests	EUR 928.00

TOMM7 Recombinant Protein (Rat)
RP234233	ABM	100 ug	Ask for price

TOMM7 Recombinant Protein (Human)
RP032560	ABM	100 ug	Ask for price

TOMM7 Recombinant Protein (Mouse)
RP180551	ABM	100 ug	Ask for price

Anti-TOMM7 Antibody (Biotin)
STJ503355	St John's Laboratory	100 µg	EUR 586.00

Anti-TOMM7 Antibody (FITC)
STJ503356	St John's Laboratory	100 µg	EUR 586.00

Tomm7 ORF Vector (Rat) (pORF)
ORF078079	ABM	1.0 ug DNA	EUR 506.00

Tomm7 ORF Vector (Mouse) (pORF)
ORF060185	ABM	1.0 ug DNA	EUR 506.00

TOMM7 ORF Vector (Human) (pORF)
ORF010854	ABM	1.0 ug DNA	EUR 95.00

Tomm7 sgRNA CRISPR Lentivector set (Rat)
K6054801	ABM	3 x 1.0 ug	EUR 339.00

Tomm7 sgRNA CRISPR Lentivector set (Mouse)
K3047801	ABM	3 x 1.0 ug	EUR 339.00

TOMM7 sgRNA CRISPR Lentivector set (Human)
K2423201	ABM	3 x 1.0 ug	EUR 339.00

TOMM7 Protein Vector (Human) (pPB-C-His)
PV043413	ABM	500 ng	EUR 329.00

TOMM7 Protein Vector (Human) (pPB-N-His)
PV043414	ABM	500 ng	EUR 329.00

TOMM7 Protein Vector (Human) (pPM-C-HA)
PV043415	ABM	500 ng	EUR 329.00

TOMM7 Protein Vector (Human) (pPM-C-His)
PV043416	ABM	500 ng	EUR 329.00

Tomm7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6054802	ABM	1.0 ug DNA	EUR 154.00

Tomm7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6054803	ABM	1.0 ug DNA	EUR 154.00

Tomm7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6054804	ABM	1.0 ug DNA	EUR 154.00

Tomm7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3047802	ABM	1.0 ug DNA	EUR 154.00

Tomm7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3047803	ABM	1.0 ug DNA	EUR 154.00

Tomm7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3047804	ABM	1.0 ug DNA	EUR 154.00

TOMM7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2423202	ABM	1.0 ug DNA	EUR 154.00

TOMM7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2423203	ABM	1.0 ug DNA	EUR 154.00

TOMM7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2423204	ABM	1.0 ug DNA	EUR 154.00

TOMM7 3'UTR Luciferase Stable Cell Line
TU026093	ABM	1.0 ml	EUR 1394.00

TOMM7 Protein Vector (Rat) (pPB-C-His)
PV312314	ABM	500 ng	EUR 603.00

TOMM7 Protein Vector (Rat) (pPB-N-His)
PV312315	ABM	500 ng	EUR 603.00

TOMM7 Protein Vector (Rat) (pPM-C-HA)
PV312316	ABM	500 ng	EUR 603.00

TOMM7 Protein Vector (Rat) (pPM-C-His)
PV312317	ABM	500 ng	EUR 603.00

TOMM7 Protein Vector (Mouse) (pPB-C-His)
PV240738	ABM	500 ng	EUR 603.00

TOMM7 Protein Vector (Mouse) (pPB-N-His)
PV240739	ABM	500 ng	EUR 603.00

TOMM7 Protein Vector (Mouse) (pPM-C-HA)
PV240740	ABM	500 ng	EUR 603.00

TOMM7 Protein Vector (Mouse) (pPM-C-His)
PV240741	ABM	500 ng	EUR 603.00

Tomm7 3'UTR Luciferase Stable Cell Line
TU222301	ABM	1.0 ml	Ask for price

TOMM7 3'UTR GFP Stable Cell Line
TU076093	ABM	1.0 ml	EUR 1394.00

Tomm7 3'UTR GFP Stable Cell Line
TU272301	ABM	1.0 ml	Ask for price

Tomm7 3'UTR GFP Stable Cell Line
TU170954	ABM	1.0 ml	Ask for price

Tomm7 3'UTR Luciferase Stable Cell Line
TU120954	ABM	1.0 ml	Ask for price

Mitochondrial Import Receptor Subunit TOM7 Homolog (TOMM7) Antibody
abx238864-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Human Mitochondrial import receptor subunit TOM7 homolog (TOMM7) ELISA Kit
abx383868-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0123-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0123-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0123-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0442-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0442-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0442-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0123-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0123-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0123-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0442-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0442-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0442-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0123-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0123-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0123-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0442-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.