TOMM7

TOMM7 siRNA
20-abx937743
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TOMM7 Rabbit pAb
A17711-200ul 200 ul
EUR 459.00
TOMM7 Rabbit pAb
A17711-50ul 50 ul
EUR 223.00
TOMM7 Rabbit pAb
A17711-100ul 100 ul
EUR 308.00
TOMM7 Rabbit pAb
A17711-20ul 20 ul
EUR 183.00
TOMM7 Polyclonal Antibody
30141-100ul 100ul
EUR 252.00
TOMM7 Polyclonal Antibody
30141-50ul 50ul
EUR 187.00
TOMM7 cloning plasmid
CSB-CL889171HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 168
  • Sequence: atggtgaagctgagcaaagaggccaagcagagactacagcagctcttcaaggggagccagtttgccattcgctggggctttatccctcttgtgatttacctgggatttaagaggggtgcagatcccggaatgcctgaaccaactgttttgagcctactttggggataa
Description: A cloning plasmid for the TOMM7 gene.
Anti-TOMM7 antibody
PAab08864 100 ug
EUR 386.00
anti- TOMM7 antibody
FNab08864 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: translocase of outer mitochondrial membrane 7 homolog(yeast)
  • Uniprot ID: Q9P0U1
  • Gene ID: 54543
  • Research Area: Signal Transduction
Description: Antibody raised against TOMM7
Anti-TOMM7 antibody
STJ119752 100 µl
EUR 277.00
Description: This gene encodes a subunit of the translocase of the outer mitochondrial membrane. The encoded protein regulates the assembly and stability of the translocase complex. [provided by RefSeq, Oct 2012]
Anti-TOMM7 Antibody
STJ503354 100 µg
EUR 476.00
Human TOMM7 shRNA Plasmid
20-abx960125
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TOMM7 shRNA Plasmid
20-abx975446
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TOMM7 Polyclonal Conjugated Antibody
C30141 100ul
EUR 397.00
Mouse Tomm7 ELISA KIT
ELI-17140m 96 Tests
EUR 865.00
TOMM7 ELISA KIT|Human
EF003745 96 Tests
EUR 689.00
Human TOMM7 ELISA KIT
ELI-40014h 96 Tests
EUR 824.00
Bovine TOMM7 ELISA KIT
ELI-23057b 96 Tests
EUR 928.00
TOMM7 Recombinant Protein (Rat)
RP234233 100 ug Ask for price
TOMM7 Recombinant Protein (Human)
RP032560 100 ug Ask for price
TOMM7 Recombinant Protein (Mouse)
RP180551 100 ug Ask for price
Anti-TOMM7 Antibody (Biotin)
STJ503355 100 µg
EUR 586.00
Anti-TOMM7 Antibody (FITC)
STJ503356 100 µg
EUR 586.00
Tomm7 ORF Vector (Rat) (pORF)
ORF078079 1.0 ug DNA
EUR 506.00
Tomm7 ORF Vector (Mouse) (pORF)
ORF060185 1.0 ug DNA
EUR 506.00
TOMM7 ORF Vector (Human) (pORF)
ORF010854 1.0 ug DNA
EUR 95.00
Tomm7 sgRNA CRISPR Lentivector set (Rat)
K6054801 3 x 1.0 ug
EUR 339.00
Tomm7 sgRNA CRISPR Lentivector set (Mouse)
K3047801 3 x 1.0 ug
EUR 339.00
TOMM7 sgRNA CRISPR Lentivector set (Human)
K2423201 3 x 1.0 ug
EUR 339.00
TOMM7 Protein Vector (Human) (pPB-C-His)
PV043413 500 ng
EUR 329.00
TOMM7 Protein Vector (Human) (pPB-N-His)
PV043414 500 ng
EUR 329.00
TOMM7 Protein Vector (Human) (pPM-C-HA)
PV043415 500 ng
EUR 329.00
TOMM7 Protein Vector (Human) (pPM-C-His)
PV043416 500 ng
EUR 329.00
Tomm7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6054802 1.0 ug DNA
EUR 154.00
Tomm7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6054803 1.0 ug DNA
EUR 154.00
Tomm7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6054804 1.0 ug DNA
EUR 154.00
Tomm7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3047802 1.0 ug DNA
EUR 154.00
Tomm7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3047803 1.0 ug DNA
EUR 154.00
Tomm7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3047804 1.0 ug DNA
EUR 154.00
TOMM7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2423202 1.0 ug DNA
EUR 154.00
TOMM7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2423203 1.0 ug DNA
EUR 154.00
TOMM7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2423204 1.0 ug DNA
EUR 154.00
TOMM7 3'UTR Luciferase Stable Cell Line
TU026093 1.0 ml
EUR 1394.00
TOMM7 Protein Vector (Rat) (pPB-C-His)
PV312314 500 ng
EUR 603.00
TOMM7 Protein Vector (Rat) (pPB-N-His)
PV312315 500 ng
EUR 603.00
TOMM7 Protein Vector (Rat) (pPM-C-HA)
PV312316 500 ng
EUR 603.00
TOMM7 Protein Vector (Rat) (pPM-C-His)
PV312317 500 ng
EUR 603.00
TOMM7 Protein Vector (Mouse) (pPB-C-His)
PV240738 500 ng
EUR 603.00
TOMM7 Protein Vector (Mouse) (pPB-N-His)
PV240739 500 ng
EUR 603.00
TOMM7 Protein Vector (Mouse) (pPM-C-HA)
PV240740 500 ng
EUR 603.00
TOMM7 Protein Vector (Mouse) (pPM-C-His)
PV240741 500 ng
EUR 603.00
Tomm7 3'UTR Luciferase Stable Cell Line
TU222301 1.0 ml Ask for price
TOMM7 3'UTR GFP Stable Cell Line
TU076093 1.0 ml
EUR 1394.00
Tomm7 3'UTR GFP Stable Cell Line
TU272301 1.0 ml Ask for price
Tomm7 3'UTR GFP Stable Cell Line
TU170954 1.0 ml Ask for price
Tomm7 3'UTR Luciferase Stable Cell Line
TU120954 1.0 ml Ask for price
Mitochondrial Import Receptor Subunit TOM7 Homolog (TOMM7) Antibody
abx238864-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Human Mitochondrial import receptor subunit TOM7 homolog (TOMM7) ELISA Kit
abx383868-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0123-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0123-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0123-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0442-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0442-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E01M0442-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0123-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0123-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0123-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0442-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0442-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E07M0442-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0123-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0123-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0123-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) ELISA kit
E02M0442-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Mitochondrial import receptor subunit TOM7 homolog(TOMM7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.