  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRAK1 antibody
70R-4215 50 ug
EUR 467
Description: Rabbit polyclonal TRAK1 antibody raised against the middle region of TRAK1
TRAK1 antibody
70R-9271 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TRAK1 antibody
TRAK1 Antibody
40166-100ul 100ul
EUR 252
TRAK1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TRAK1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TRAK1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
YF-PA27505 50 ul
EUR 363
Description: Mouse polyclonal to TRAK1
TRAK1 Conjugated Antibody
C40166 100ul
EUR 397
TRAK1 Polyclonal Antibody
ES10361-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRAK1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TRAK1 Polyclonal Antibody
ES10361-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRAK1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TRAK1 Polyclonal Antibody
ABP60749-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TRAK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRAK1 from Human, Mouse. This TRAK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRAK1 protein
TRAK1 Polyclonal Antibody
ABP60749-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TRAK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRAK1 from Human, Mouse. This TRAK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRAK1 protein
TRAK1 Polyclonal Antibody
ABP60749-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TRAK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRAK1 from Human, Mouse. This TRAK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRAK1 protein
TRAK1 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TRAK1 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TRAK1 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TRAK1 Rabbit pAb
A15249-100ul 100 ul
EUR 308
TRAK1 Rabbit pAb
A15249-200ul 200 ul
EUR 459
TRAK1 Rabbit pAb
A15249-20ul 20 ul
EUR 183
TRAK1 Rabbit pAb
A15249-50ul 50 ul
EUR 223
TRAK1 Polyclonal Antibody
A68042 100 µg
EUR 570.55
Description: fast delivery possible
TRAK1 Blocking Peptide
33R-4044 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAK1 antibody, catalog no. 70R-4215
TRAK1 Blocking Peptide
33R-4220 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAK1 antibody, catalog no. 70R-9271
TRAK1 cloning plasmid
CSB-CL891465HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2067
  • Sequence: atgtccctgcgagacaagggcggggaagaagaatgttttgaatacgactgccaggatgaagagaggaagccaacccacaggcagcatgacacccaggacctcttggaagaggttttatgtgctgaaagagttggccagatgactaagacatataatgacatagatgctgtcactc
  • Show more
Description: A cloning plasmid for the TRAK1 gene.
Anti-TRAK1 antibody
STJ117443 100 µl
EUR 277
Anti-TRAK1 antibody
STJ191519 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRAK1
Mouse TRAK1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TRAK1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TRAK1 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TRAK1 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TRAK1 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRAK1. Recognizes TRAK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-OIP106 / TRAK1 antibody
STJ70641 100 µg
EUR 359
Polyclonal TRAK1 antibody - middle region
APR01249G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAK1 - middle region. This antibody is tested and proven to work in the following applications:
Polyclonal TRAK1 antibody - middle region
APR01250G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAK1 - middle region. This antibody is tested and proven to work in the following applications:
TRAK1 Polyclonal Antibody, HRP Conjugated
A68043 100 µg
EUR 570.55
Description: reagents widely cited
TRAK1 Polyclonal Antibody, FITC Conjugated
A68044 100 µg
EUR 570.55
Description: Ask the seller for details
TRAK1 Polyclonal Antibody, Biotin Conjugated
A68045 100 µg
EUR 570.55
Description: The best epigenetics products
Trak1 ORF Vector (Rat) (pORF)
ORF078176 1.0 ug DNA
EUR 506
TRAK1 ORF Vector (Human) (pORF)
ORF010927 1.0 ug DNA
EUR 95
Trak1 ORF Vector (Mouse) (pORF)
ORF060293 1.0 ug DNA
EUR 506
Polyclonal Goat Anti-OIP106 / TRAK1 Antibody
APG00224G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-OIP106 / TRAK1 . This antibody is tested and proven to work in the following applications:
Trafficking Kinesin Protein 1 (TRAK1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Trafficking Kinesin Protein 1 (TRAK1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Trafficking Kinesin Protein 1 (TRAK1) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
TRAK1 sgRNA CRISPR Lentivector set (Human)
K2439901 3 x 1.0 ug
EUR 339
Trak1 sgRNA CRISPR Lentivector set (Mouse)
K3460601 3 x 1.0 ug
EUR 339
Trak1 sgRNA CRISPR Lentivector set (Rat)
K6172201 3 x 1.0 ug
EUR 339
TRAK1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2439902 1.0 ug DNA
EUR 154
TRAK1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2439903 1.0 ug DNA
EUR 154
TRAK1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2439904 1.0 ug DNA
EUR 154
Trak1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3460602 1.0 ug DNA
EUR 154
Trak1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3460603 1.0 ug DNA
EUR 154
Trak1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3460604 1.0 ug DNA
EUR 154
Trak1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6172202 1.0 ug DNA
EUR 154
Trak1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6172203 1.0 ug DNA
EUR 154
Trak1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6172204 1.0 ug DNA
EUR 154
TRAK1 Protein Vector (Human) (pPB-C-His)
PV043705 500 ng
EUR 329
TRAK1 Protein Vector (Human) (pPB-N-His)
PV043706 500 ng
EUR 329
TRAK1 Protein Vector (Human) (pPM-C-HA)
PV043707 500 ng
EUR 329
TRAK1 Protein Vector (Human) (pPM-C-His)
PV043708 500 ng
EUR 329
TRAK1 Protein Vector (Rat) (pPB-C-His)
PV312702 500 ng
EUR 1191
TRAK1 Protein Vector (Rat) (pPB-N-His)
PV312703 500 ng
EUR 1191
TRAK1 Protein Vector (Rat) (pPM-C-HA)
PV312704 500 ng
EUR 1191
TRAK1 Protein Vector (Rat) (pPM-C-His)
PV312705 500 ng
EUR 1191
TRAK1 Protein Vector (Mouse) (pPB-C-His)
PV241170 500 ng
EUR 1065
TRAK1 Protein Vector (Mouse) (pPB-N-His)
PV241171 500 ng
EUR 1065
TRAK1 Protein Vector (Mouse) (pPM-C-HA)
PV241172 500 ng
EUR 1065
TRAK1 Protein Vector (Mouse) (pPM-C-His)
PV241173 500 ng
EUR 1065
Trak1 3'UTR GFP Stable Cell Line
TU171029 1.0 ml Ask for price
TRAK1 3'UTR GFP Stable Cell Line
TU076279 1.0 ml
EUR 2333
Trak1 3'UTR Luciferase Stable Cell Line
TU121029 1.0 ml Ask for price
TRAK1 3'UTR Luciferase Stable Cell Line
TU026279 1.0 ml
EUR 2333
Trak1 3'UTR Luciferase Stable Cell Line
TU222382 1.0 ml Ask for price
Trak1 3'UTR GFP Stable Cell Line
TU272382 1.0 ml Ask for price