TUBA4A

Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
DLR-TUBa4A-Hu-96T 96T
EUR 673
  • Should the Human Tubulin Alpha 4A (TUBa4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Alpha 4A (TUBa4A) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
DLR-TUBa4A-Mu-48T 48T
EUR 527
  • Should the Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Alpha 4A (TUBa4A) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
DLR-TUBa4A-Mu-96T 96T
EUR 688
  • Should the Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Alpha 4A (TUBa4A) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
DLR-TUBa4A-Ra-48T 48T
EUR 549
  • Should the Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tubulin Alpha 4A (TUBa4A) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
DLR-TUBa4A-Ra-96T 96T
EUR 718
  • Should the Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tubulin Alpha 4A (TUBa4A) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Hu-48Tests 48 Tests
EUR 544
Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Hu-96Tests 96 Tests
EUR 756
Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Mu-48Tests 48 Tests
EUR 557
Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Mu-96Tests 96 Tests
EUR 774
Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Ra-48Tests 48 Tests
EUR 583
Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Ra-96Tests 96 Tests
EUR 811
Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Hu-48Tests 48 Tests
EUR 521
Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Hu-96Tests 96 Tests
EUR 723
Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Mu-48Tests 48 Tests
EUR 533
Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Mu-96Tests 96 Tests
EUR 740
Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Ra-48Tests 48 Tests
EUR 557
Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Ra-96Tests 96 Tests
EUR 775
Tuba4a/ Rat Tuba4a ELISA Kit
ELI-29136r 96 Tests
EUR 886
TUBA4A siRNA
20-abx905866
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBA4A siRNA
20-abx938552
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBA4A siRNA
20-abx938553
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBA4A Antibody
ABD6081 100 ug
EUR 438
TUBA4A Antibody
ABD7240 100 ug
EUR 438
TUBA4A antibody
38626-100ul 100ul
EUR 252
TUBA4A Antibody
32061-100ul 100ul
EUR 252
TUBA4A Antibody
DF6081 200ul
EUR 304
Description: TUBA4A Antibody detects endogenous levels of total TUBA4A.
TUBA4A Antibody
DF7240 200ul
EUR 304
Description: TUBA4A Antibody detects endogenous levels of total TUBA4A.
TUBA4A Antibody
1-CSB-PA09499A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA4A. Recognizes TUBA4A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000
TUBA4A Antibody
1-CSB-PA025313GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TUBA4A. Recognizes TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA
TUBA4A Conjugated Antibody
C32061 100ul
EUR 397
TUBA4A cloning plasmid
CSB-CL025313HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1347
  • Sequence: atgcgtgaatgcatctcagtccacgtggggcaggcaggtgtccagatgggcaatgcctgctgggagctctattgcttggaacatgggattcagcctgatgggcagatgcccagtgacaagaccattggtggaggggacgactccttcaccaccttcttctgtgaaactggtgctg
  • Show more
Description: A cloning plasmid for the TUBA4A gene.
TUBA4A Blocking Peptide
DF6081-BP 1mg
EUR 195
TUBA4A Blocking Peptide
DF7240-BP 1mg
EUR 195
TUBA4A Rabbit pAb
AC007 50 ul
EUR 195
TUBA4A Rabbit pAb
AC014 50 ul
EUR 223
TUBA4A Rabbit pAb
AC031 50 ul
EUR 195
Anti-TUBA4A antibody
STJ140051 200 µg
EUR 270
Description: Goat polyclonal antibody to alpha tubulin. Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly.
Anti-TUBA4A antibody
STJ140087 150 µg
EUR 219
Description: Goat polyclonal antibody to alpha tubulin. Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly.
Rat TUBA4A shRNA Plasmid
20-abx989960
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TUBA4A shRNA Plasmid
20-abx954975
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TUBA4A shRNA Plasmid
20-abx973255
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TUBA4A Antibody, HRP conjugated
1-CSB-PA09499B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA4A. Recognizes TUBA4A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TUBA4A Antibody, FITC conjugated
1-CSB-PA09499C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA4A. Recognizes TUBA4A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TUBA4A Antibody, Biotin conjugated
1-CSB-PA09499D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA4A. Recognizes TUBA4A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TUBA4A Recombinant Protein (Human)
RP033430 100 ug Ask for price
TUBA4A Recombinant Protein (Rat)
RP235265 100 ug Ask for price
TUBA4A Recombinant Protein (Mouse)
RP182225 100 ug Ask for price
Polyclonal TUBA4A Antibody (C-term)
APR13862G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBA4A (C-term). This antibody is tested and proven to work in the following applications:
Tubulin, Alpha 4A (TUBA4A) Antibody
20-abx116347
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Alpha 4A (TUBA4A) Antibody
abx147277-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Tubulin Alpha 4A (TUBA4A) Antibody
abx147278-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Tubulin Alpha 4A (TUBA4A) Antibody
abx027448-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tubulin Alpha 4A (TUBA4A) Antibody
abx027448-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tubulin Alpha 4A (TUBA4A) Antibody
20-abx317902
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Alpha 4A (TUBa4A) Antibody
20-abx178746
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tubulin Alpha 4A (TUBa4A) Antibody
20-abx178747
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tuba4a ORF Vector (Rat) (pORF)
ORF078423 1.0 ug DNA
EUR 506
TUBA4A ORF Vector (Human) (pORF)
ORF011144 1.0 ug DNA
EUR 95
Tuba4a ORF Vector (Mouse) (pORF)
ORF060743 1.0 ug DNA
EUR 506
Tuba4a ELISA Kit (Mouse) (OKCD01832)
OKCD01832 96 Wells
EUR 857
Description: Description of target: Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.124 ng/mL
Mouse Tubulin Alpha 4A (TUBa4A) Protein
20-abx655368
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Tubulin Alpha 4A (TUBa4A) Protein
20-abx655369
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA4A Antibody
20-abx327431
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Alpha 4A (TUBA4A) Antibody (HRP)
20-abx314416
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Alpha 4A (TUBA4A) Antibody (FITC)
20-abx314417
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tubulin Alpha 4A (TUBA4A) Antibody (Biotin)
20-abx314418
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA4A sgRNA CRISPR Lentivector set (Human)
K2557701 3 x 1.0 ug
EUR 339
TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A Antibody
1-CSB-PA005736
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A. Recognizes TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
Tuba4a sgRNA CRISPR Lentivector set (Mouse)
K3204001 3 x 1.0 ug
EUR 339
Tuba4a sgRNA CRISPR Lentivector set (Rat)
K7230501 3 x 1.0 ug
EUR 339
Mouse Tubulin Alpha 4A (TUBA4A) ELISA Kit
20-abx154819
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA3E / TUBA4A Antibody
20-abx327137
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA8 / TUBA4A Antibody
20-abx329824
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse Tubulin Alpha 4A (TUBA4A) CLIA Kit
20-abx494709
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
TUBA4A sgRNA CRISPR Lentivector (Human) (Target 1)
K2557702 1.0 ug DNA
EUR 154