TUBA4A

Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
DLR-TUBa4A-Hu-96T	DL Develop	96T	EUR 673.00
Should the Human Tubulin Alpha 4A (TUBa4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Alpha 4A (TUBa4A) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
DLR-TUBa4A-Mu-48T	DL Develop	48T	EUR 527.00
Should the Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Alpha 4A (TUBa4A) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
DLR-TUBa4A-Mu-96T	DL Develop	96T	EUR 688.00
Should the Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Tubulin Alpha 4A (TUBa4A) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
DLR-TUBa4A-Ra-48T	DL Develop	48T	EUR 549.00
Should the Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tubulin Alpha 4A (TUBa4A) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
DLR-TUBa4A-Ra-96T	DL Develop	96T	EUR 718.00
Should the Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tubulin Alpha 4A (TUBa4A) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
DL-TUBa4A-Hu-192	DLdevelop	1 kit of 192 tests	EUR 1152.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Alpha 4A (TUBa4A)

Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
DL-TUBa4A-Hu-48	DLdevelop	1 kit of 48 tests	EUR 482.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Alpha 4A (TUBa4A)

Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
DL-TUBa4A-Hu-96	DLdevelop	1 kit of 96 tests	EUR 646.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Tubulin Alpha 4A (TUBa4A)

Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
DL-TUBa4A-Mu-192	DLdevelop	1 kit of 192 tests	EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tubulin Alpha 4A (TUBa4A)

Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
DL-TUBa4A-Mu-48	DLdevelop	1 kit of 48 tests	EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tubulin Alpha 4A (TUBa4A)

Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
DL-TUBa4A-Mu-96	DLdevelop	1 kit of 96 tests	EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse Tubulin Alpha 4A (TUBa4A)

Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
DL-TUBa4A-Ra-192	DLdevelop	1 kit of 192 tests	EUR 1237.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Tubulin Alpha 4A (TUBa4A)

Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
DL-TUBa4A-Ra-48	DLdevelop	1 kit of 48 tests	EUR 512.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Tubulin Alpha 4A (TUBa4A)

Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
DL-TUBa4A-Ra-96	DLdevelop	1 kit of 96 tests	EUR 688.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Tubulin Alpha 4A (TUBa4A)

Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521.00

Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723.00

Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533.00

Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740.00

Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557.00

Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
RD-TUBa4A-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775.00

Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544.00

Human Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756.00

Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557.00

Mouse Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774.00

Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583.00

Rat Tubulin Alpha 4A (TUBa4A) ELISA Kit
RDR-TUBa4A-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811.00

Tuba4a/ Rat Tuba4a ELISA Kit
ELI-29136r	Lifescience Market	96 Tests	EUR 886.00

TUBA4A Antibody
1-CSB-PA09499A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA4A. Recognizes TUBA4A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

TUBA4A Antibody
1-CSB-PA025313GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TUBA4A. Recognizes TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

TUBA4A Antibody
32061-100ul	SAB	100ul	EUR 252.00

TUBA4A antibody
38626-100ul	SAB	100ul	EUR 252.00

TUBA4A siRNA
20-abx905866	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBA4A siRNA
20-abx938552	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBA4A siRNA
20-abx938553	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBA4A Antibody
DF6081	Affbiotech	200ul	EUR 304.00
Description: TUBA4A Antibody detects endogenous levels of total TUBA4A.

TUBA4A Antibody
DF7240	Affbiotech	200ul	EUR 304.00
Description: TUBA4A Antibody detects endogenous levels of total TUBA4A.

TUBA4A Antibody
ABD6081	Lifescience Market	100 ug	EUR 438.00

TUBA4A Antibody
ABD7240	Lifescience Market	100 ug	EUR 438.00

TUBA4A Rabbit pAb
AC007	Abclonal	50 ul	EUR 195.00

TUBA4A Rabbit pAb
AC014	Abclonal	50 ul	EUR 223.00

TUBA4A Rabbit pAb
AC031	Abclonal	50 ul	EUR 195.00

TUBA4A Conjugated Antibody
C32061	SAB	100ul	EUR 397.00

TUBA4A cloning plasmid
CSB-CL025313HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1347 Sequence: atgcgtgaatgcatctcagtccacgtggggcaggcaggtgtccagatgggcaatgcctgctgggagctctattgcttggaacatgggattcagcctgatgggcagatgcccagtgacaagaccattggtggaggggacgactccttcaccaccttcttctgtgaaactggtgctg Show more
Description: A cloning plasmid for the TUBA4A gene.

TUBA4A Blocking Peptide
DF6081-BP	Affbiotech	1mg	EUR 195.00

TUBA4A Blocking Peptide
DF7240-BP	Affbiotech	1mg	EUR 195.00

Anti-TUBA4A antibody
STJ140051	St John's Laboratory	200 µg	EUR 270.00
Description: Goat polyclonal antibody to alpha tubulin. Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly.

Anti-TUBA4A antibody
STJ140087	St John's Laboratory	150 µg	EUR 219.00
Description: Goat polyclonal antibody to alpha tubulin. Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly.

Rat TUBA4A shRNA Plasmid
20-abx989960	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TUBA4A Antibody, HRP conjugated
1-CSB-PA09499B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA4A. Recognizes TUBA4A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TUBA4A Antibody, FITC conjugated
1-CSB-PA09499C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA4A. Recognizes TUBA4A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TUBA4A Antibody, Biotin conjugated
1-CSB-PA09499D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBA4A. Recognizes TUBA4A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human TUBA4A shRNA Plasmid
20-abx954975	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TUBA4A shRNA Plasmid
20-abx973255	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TUBA4A Recombinant Protein (Rat)
RP235265	ABM	100 ug	Ask for price

TUBA4A Recombinant Protein (Human)
RP033430	ABM	100 ug	Ask for price

TUBA4A Recombinant Protein (Mouse)
RP182225	ABM	100 ug	Ask for price

Tubulin Alpha 4A (TUBA4A) Antibody
abx147277-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

Tubulin Alpha 4A (TUBA4A) Antibody
abx147278-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

Tubulin, Alpha 4A (TUBA4A) Antibody
20-abx116347	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Polyclonal TUBA4A Antibody (C-term)
APR13862G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBA4A (C-term). This antibody is tested and proven to work in the following applications:

Tubulin Alpha 4A (TUBA4A) Antibody
abx027448-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Tubulin Alpha 4A (TUBA4A) Antibody
abx027448-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Tubulin Alpha 4A (TUBa4A) Antibody
20-abx178746	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Tubulin Alpha 4A (TUBa4A) Antibody
20-abx178747	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Tubulin Alpha 4A (TUBA4A) Antibody
20-abx317902	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TUBA4A ORF Vector (Human) (pORF)
ORF011144	ABM	1.0 ug DNA	EUR 95.00

Tuba4a ORF Vector (Mouse) (pORF)
ORF060743	ABM	1.0 ug DNA	EUR 506.00

Tuba4a ORF Vector (Rat) (pORF)
ORF078423	ABM	1.0 ug DNA	EUR 506.00

TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A Antibody
1-CSB-PA005736	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A. Recognizes TUBA1A/TUBA1B/TUBA1C/TUBA3C/TUBA4A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TUBA1A / TUBA1B / TUBA1C / TUBA3C / TUBA4A Antibody
20-abx327431	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Mouse Tubulin Alpha 4A (TUBa4A) Protein
20-abx655368	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Tubulin Alpha 4A (TUBa4A) Protein
20-abx655369	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Tubulin Alpha 4A (TUBA4A) Antibody (HRP)
20-abx314416	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Alpha 4A (TUBA4A) Antibody (FITC)
20-abx314417	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tubulin Alpha 4A (TUBA4A) Antibody (Biotin)
20-abx314418	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.