TUBB2B

TUBB2B antibody
70R-21060	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TUBB2B antibody

TUBB2b antibody
10R-1184	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal TUBB2b antibody

TUBB2B Antibody
1-CSB-PA025321GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TUBB2B. Recognizes TUBB2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

TUBB2B siRNA
20-abx905869	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBB2B siRNA
20-abx938562	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TUBB2B siRNA
20-abx938563	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-TUBB2B
PVT18477	Lifescience Market	2 ug	EUR 231

TUBB2B cloning plasmid
CSB-CL866291HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1338 Sequence: atgcgtgagatcgtgcacatccaggcgggccagtgcggcaaccagatcggcgccaagttttgggaggtcatcagtgatgagcatgggattgaccccactggcagttaccatggagacagtgatttgcagctggagagaatcaatgtttactacaatgaagccactggtaacaaat Show more
Description: A cloning plasmid for the TUBB2B gene.

Rat TUBB2B shRNA Plasmid
20-abx988485	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TUBB2B shRNA Plasmid
20-abx978007	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TUBB2B shRNA Plasmid
20-abx967514	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TUBB2B Recombinant Protein (Rat)
RP235277	ABM	100 ug	Ask for price

TUBB2B Recombinant Protein (Human)
RP033448	ABM	100 ug	Ask for price

TUBB2B Recombinant Protein (Mouse)
RP182240	ABM	100 ug	Ask for price

Polyclonal TUBB2B Antibody (N-term)
AMM08383G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBB2B (N-term). This antibody is tested and proven to work in the following applications:

Tubulin Beta 2B (TUBB2B) Antibody
abx026514-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tubulin Beta 2B (TUBB2B) Antibody
abx026514-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tubulin, Beta 2B (TUBB2B) Antibody
20-abx116350	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tubulin Beta 2B (TUBB2B) Antibody
abx145775-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tubulin Beta 2B (TUBB2B) Antibody
20-abx137361	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Tubb2b ORF Vector (Rat) (pORF)
ORF078427	ABM	1.0 ug DNA	EUR 506

TUBB2B ORF Vector (Human) (pORF)
ORF011150	ABM	1.0 ug DNA	EUR 95

Tubb2b ORF Vector (Mouse) (pORF)
ORF060748	ABM	1.0 ug DNA	EUR 506

Tubb2b sgRNA CRISPR Lentivector set (Rat)
K7326701	ABM	3 x 1.0 ug	EUR 339

Tubb2b sgRNA CRISPR Lentivector set (Mouse)
K3533201	ABM	3 x 1.0 ug	EUR 339

TUBB2B sgRNA CRISPR Lentivector set (Human)
K2558601	ABM	3 x 1.0 ug	EUR 339

Monoclonal TUBB2B Antibody (clone AT5B3), Clone: AT5B3
AMM08382G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human TUBB2B (clone AT5B3). The antibodies are raised in Mouse and are from clone AT5B3. This antibody is applicable in IHC-P

Tubb2b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7326702	ABM	1.0 ug DNA	EUR 154

Tubb2b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7326703	ABM	1.0 ug DNA	EUR 154

Tubb2b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7326704	ABM	1.0 ug DNA	EUR 154

Tubb2b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3533202	ABM	1.0 ug DNA	EUR 154

Tubb2b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3533203	ABM	1.0 ug DNA	EUR 154

Tubb2b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3533204	ABM	1.0 ug DNA	EUR 154

TUBB2B sgRNA CRISPR Lentivector (Human) (Target 1)
K2558602	ABM	1.0 ug DNA	EUR 154

TUBB2B sgRNA CRISPR Lentivector (Human) (Target 2)
K2558603	ABM	1.0 ug DNA	EUR 154

TUBB2B sgRNA CRISPR Lentivector (Human) (Target 3)
K2558604	ABM	1.0 ug DNA	EUR 154

TUBB2B Protein Vector (Mouse) (pPB-C-His)
PV242990	ABM	500 ng	EUR 603

TUBB2B Protein Vector (Mouse) (pPB-N-His)
PV242991	ABM	500 ng	EUR 603

TUBB2B Protein Vector (Mouse) (pPM-C-HA)
PV242992	ABM	500 ng	EUR 603

TUBB2B Protein Vector (Mouse) (pPM-C-His)
PV242993	ABM	500 ng	EUR 603

TUBB2B Protein Vector (Rat) (pPB-C-His)
PV313706	ABM	500 ng	EUR 603

TUBB2B Protein Vector (Rat) (pPB-N-His)
PV313707	ABM	500 ng	EUR 603

TUBB2B Protein Vector (Rat) (pPM-C-HA)
PV313708	ABM	500 ng	EUR 603

TUBB2B Protein Vector (Rat) (pPM-C-His)
PV313709	ABM	500 ng	EUR 603

TUBB2B Protein Vector (Human) (pPB-C-His)
PV044597	ABM	500 ng	EUR 329

TUBB2B Protein Vector (Human) (pPB-N-His)
PV044598	ABM	500 ng	EUR 329

TUBB2B Protein Vector (Human) (pPM-C-HA)
PV044599	ABM	500 ng	EUR 329

TUBB2B Protein Vector (Human) (pPM-C-His)
PV044600	ABM	500 ng	EUR 329

Tubb2b 3'UTR Luciferase Stable Cell Line
TU121359	ABM	1.0 ml	Ask for price

TUBB2B 3'UTR GFP Stable Cell Line
TU077521	ABM	1.0 ml	EUR 1394

Tubb2b 3'UTR GFP Stable Cell Line
TU171359	ABM	1.0 ml	Ask for price

Tubb2b 3'UTR Luciferase Stable Cell Line
TU222655	ABM	1.0 ml	Ask for price

TUBB2B 3'UTR Luciferase Stable Cell Line
TU027521	ABM	1.0 ml	EUR 1394

Tubb2b 3'UTR GFP Stable Cell Line
TU272655	ABM	1.0 ml	Ask for price

Bovine Tubulin beta- 2B chain, TUBB2B ELISA KIT
ELI-18808b	Lifescience Market	96 Tests	EUR 928

Mouse Tubulin beta- 2B chain, Tubb2b ELISA KIT
ELI-52874m	Lifescience Market	96 Tests	EUR 865

Human Tubulin beta- 2B chain, TUBB2B ELISA KIT
ELI-53135h	Lifescience Market	96 Tests	EUR 824

TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662527	ABM	1.0 ug DNA	EUR 682

TUBB2B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662531	ABM	1.0 ug DNA	EUR 682

TUBB2B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662532	ABM	1.0 ug DNA	EUR 682

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7326705	ABM	3 x 1.0 ug	EUR 376

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3533205	ABM	3 x 1.0 ug	EUR 376

TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2558605	ABM	3 x 1.0 ug	EUR 376

TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV662528	ABM	1.0 ug DNA	EUR 682

TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV662529	ABM	1.0 ug DNA	EUR 740

TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV662530	ABM	1.0 ug DNA	EUR 740

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7326706	ABM	1.0 ug DNA	EUR 167

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7326707	ABM	1.0 ug DNA	EUR 167

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7326708	ABM	1.0 ug DNA	EUR 167

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3533206	ABM	1.0 ug DNA	EUR 167

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3533207	ABM	1.0 ug DNA	EUR 167

Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3533208	ABM	1.0 ug DNA	EUR 167

TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2558606	ABM	1.0 ug DNA	EUR 167

TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2558607	ABM	1.0 ug DNA	EUR 167

TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2558608	ABM	1.0 ug DNA	EUR 167