TUBB2B

TUBB2B antibody
70R-21060 50 ul
EUR 435
Description: Rabbit polyclonal TUBB2B antibody
TUBB2b antibody
10R-1184 100 ul
EUR 316
Description: Mouse monoclonal TUBB2b antibody
TUBB2B Antibody
1-CSB-PA025321GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TUBB2B. Recognizes TUBB2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA
TUBB2B siRNA
20-abx905869
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBB2B siRNA
20-abx938562
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TUBB2B siRNA
20-abx938563
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-TUBB2B
PVT18477 2 ug
EUR 231
TUBB2B cloning plasmid
CSB-CL866291HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1338
  • Sequence: atgcgtgagatcgtgcacatccaggcgggccagtgcggcaaccagatcggcgccaagttttgggaggtcatcagtgatgagcatgggattgaccccactggcagttaccatggagacagtgatttgcagctggagagaatcaatgtttactacaatgaagccactggtaacaaat
  • Show more
Description: A cloning plasmid for the TUBB2B gene.
Rat TUBB2B shRNA Plasmid
20-abx988485
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TUBB2B shRNA Plasmid
20-abx978007
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TUBB2B shRNA Plasmid
20-abx967514
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TUBB2B Recombinant Protein (Rat)
RP235277 100 ug Ask for price
TUBB2B Recombinant Protein (Human)
RP033448 100 ug Ask for price
TUBB2B Recombinant Protein (Mouse)
RP182240 100 ug Ask for price
Polyclonal TUBB2B Antibody (N-term)
AMM08383G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TUBB2B (N-term). This antibody is tested and proven to work in the following applications:
Tubulin Beta 2B (TUBB2B) Antibody
abx026514-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tubulin Beta 2B (TUBB2B) Antibody
abx026514-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tubulin, Beta 2B (TUBB2B) Antibody
20-abx116350
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Beta 2B (TUBB2B) Antibody
abx145775-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tubulin Beta 2B (TUBB2B) Antibody
20-abx137361
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Tubb2b ORF Vector (Rat) (pORF)
ORF078427 1.0 ug DNA
EUR 506
TUBB2B ORF Vector (Human) (pORF)
ORF011150 1.0 ug DNA
EUR 95
Tubb2b ORF Vector (Mouse) (pORF)
ORF060748 1.0 ug DNA
EUR 506
Tubb2b sgRNA CRISPR Lentivector set (Rat)
K7326701 3 x 1.0 ug
EUR 339
Tubb2b sgRNA CRISPR Lentivector set (Mouse)
K3533201 3 x 1.0 ug
EUR 339
TUBB2B sgRNA CRISPR Lentivector set (Human)
K2558601 3 x 1.0 ug
EUR 339
Monoclonal TUBB2B Antibody (clone AT5B3), Clone: AT5B3
AMM08382G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human TUBB2B (clone AT5B3). The antibodies are raised in Mouse and are from clone AT5B3. This antibody is applicable in IHC-P
Tubb2b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7326702 1.0 ug DNA
EUR 154
Tubb2b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7326703 1.0 ug DNA
EUR 154
Tubb2b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7326704 1.0 ug DNA
EUR 154
Tubb2b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3533202 1.0 ug DNA
EUR 154
Tubb2b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3533203 1.0 ug DNA
EUR 154
Tubb2b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3533204 1.0 ug DNA
EUR 154
TUBB2B sgRNA CRISPR Lentivector (Human) (Target 1)
K2558602 1.0 ug DNA
EUR 154
TUBB2B sgRNA CRISPR Lentivector (Human) (Target 2)
K2558603 1.0 ug DNA
EUR 154
TUBB2B sgRNA CRISPR Lentivector (Human) (Target 3)
K2558604 1.0 ug DNA
EUR 154
TUBB2B Protein Vector (Mouse) (pPB-C-His)
PV242990 500 ng
EUR 603
TUBB2B Protein Vector (Mouse) (pPB-N-His)
PV242991 500 ng
EUR 603
TUBB2B Protein Vector (Mouse) (pPM-C-HA)
PV242992 500 ng
EUR 603
TUBB2B Protein Vector (Mouse) (pPM-C-His)
PV242993 500 ng
EUR 603
TUBB2B Protein Vector (Rat) (pPB-C-His)
PV313706 500 ng
EUR 603
TUBB2B Protein Vector (Rat) (pPB-N-His)
PV313707 500 ng
EUR 603
TUBB2B Protein Vector (Rat) (pPM-C-HA)
PV313708 500 ng
EUR 603
TUBB2B Protein Vector (Rat) (pPM-C-His)
PV313709 500 ng
EUR 603
TUBB2B Protein Vector (Human) (pPB-C-His)
PV044597 500 ng
EUR 329
TUBB2B Protein Vector (Human) (pPB-N-His)
PV044598 500 ng
EUR 329
TUBB2B Protein Vector (Human) (pPM-C-HA)
PV044599 500 ng
EUR 329
TUBB2B Protein Vector (Human) (pPM-C-His)
PV044600 500 ng
EUR 329
Tubb2b 3'UTR Luciferase Stable Cell Line
TU121359 1.0 ml Ask for price
TUBB2B 3'UTR GFP Stable Cell Line
TU077521 1.0 ml
EUR 1394
Tubb2b 3'UTR GFP Stable Cell Line
TU171359 1.0 ml Ask for price
Tubb2b 3'UTR Luciferase Stable Cell Line
TU222655 1.0 ml Ask for price
TUBB2B 3'UTR Luciferase Stable Cell Line
TU027521 1.0 ml
EUR 1394
Tubb2b 3'UTR GFP Stable Cell Line
TU272655 1.0 ml Ask for price
Bovine Tubulin beta- 2B chain, TUBB2B ELISA KIT
ELI-18808b 96 Tests
EUR 928
Mouse Tubulin beta- 2B chain, Tubb2b ELISA KIT
ELI-52874m 96 Tests
EUR 865
Human Tubulin beta- 2B chain, TUBB2B ELISA KIT
ELI-53135h 96 Tests
EUR 824
TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV662527 1.0 ug DNA
EUR 682
TUBB2B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV662531 1.0 ug DNA
EUR 682
TUBB2B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV662532 1.0 ug DNA
EUR 682
Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7326705 3 x 1.0 ug
EUR 376
Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3533205 3 x 1.0 ug
EUR 376
TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2558605 3 x 1.0 ug
EUR 376
TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV662528 1.0 ug DNA
EUR 682
TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV662529 1.0 ug DNA
EUR 740
TUBB2B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV662530 1.0 ug DNA
EUR 740
Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7326706 1.0 ug DNA
EUR 167
Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7326707 1.0 ug DNA
EUR 167
Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7326708 1.0 ug DNA
EUR 167
Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3533206 1.0 ug DNA
EUR 167
Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3533207 1.0 ug DNA
EUR 167
Tubb2b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3533208 1.0 ug DNA
EUR 167
TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2558606 1.0 ug DNA
EUR 167
TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2558607 1.0 ug DNA
EUR 167
TUBB2B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2558608 1.0 ug DNA
EUR 167