UCN

Ucn/ Rat Ucn ELISA Kit
ELI-07052r	Lifescience Market	96 Tests	EUR 886

UCN-01
C4783-1	ApexBio	1 mg	EUR 266

UCN-02
C4829-1	ApexBio	1 mg	EUR 460
Description: UCN-02 is a derivative of staurosporine and a stereoisomer of UCN-01, which has been first isolated from a high staurosporine-producing Streptomyces culture as a minor co-metabolite [1]. UCN-02 is protein kinase C inhibitor [1].

UCN-02
C4829-5	ApexBio	5 mg	EUR 1488
Description: UCN-02 is a derivative of staurosporine and a stereoisomer of UCN-01, which has been first isolated from a high staurosporine-producing Streptomyces culture as a minor co-metabolite [1]. UCN-02 is protein kinase C inhibitor [1].

UCN-02
HY-108262	MedChemExpress	1mg	EUR 727

UCN antibody
70R-21144	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal UCN antibody

UCN Antibody
37061-100ul	SAB	100ul	EUR 252

UCN Antibody
CSB-PA841116-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against UCN. Recognizes UCN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

UCN Antibody
CSB-PA841116-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against UCN. Recognizes UCN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

UCN Antibody
1-CSB-PA254368	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCN. Recognizes UCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

UCN Antibody
1-CSB-PA060039	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UCN. Recognizes UCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

UCN Antibody
1-CSB-PA025551GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UCN. Recognizes UCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

UCN-01
U005-1MG	TOKU-E	1 mg	EUR 355

UCN-01
U005-5MG	TOKU-E	5 mg	EUR 1167

UCN-02
U006-1MG	TOKU-E	1 mg	EUR 331

UCN-02
U006-5MG	TOKU-E	5 mg	EUR 1082

UCN Conjugated Antibody
C37061	SAB	100ul	EUR 397

UCN cloning plasmid
CSB-CL025551HU-10ug	Cusabio	10ug	EUR 215
Formulation: 10 μg plasmid + 200μl Glycerol Length: 375 Sequence: ATGAGGCAGGCGGGACGCGCAGCGCTGCTGGCCGCGCTGCTGCTCCTGGTACAGCTGTGCCCTGGGAGCAGCCAGAGGAGCCCCGAGGCGGCCGGGGTCCAGGACCCGAGTCTGCGCTGGAGCCCCGGGGCACGGAACCAGGGTGGCGGGGCCCGCGCGCTCCTCTTGCTGCTGGC Show more
Description: A cloning plasmid for the UCN gene.

Urocortin (UCN) Antibody
20-abx116545	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Urocortin (UCN) Antibody
20-abx013246	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Urocortin (UCN) Antibody
20-abx326440	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Urocortin (UCN) Antibody
abx331335-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Urocortin (UCN) Antibody
abx239291-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Urocortin (UCN) Antibody
20-abx241444	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Rat UCN shRNA Plasmid
20-abx985316	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human UCN ELISA Kit
ELA-E2199h	Lifescience Market	96 Tests	EUR 824

UCN ELISA KIT|Human
EF006232	Lifescience Market	96 Tests	EUR 689

Human UCN shRNA Plasmid
20-abx955024	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse UCN shRNA Plasmid
20-abx973300	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UCN Recombinant Protein (Human)
RP044626	ABM	100 ug	Ask for price

UCN Recombinant Protein (Rat)
RP235733	ABM	100 ug	Ask for price

UCN Recombinant Protein (Mouse)
RP182936	ABM	100 ug	Ask for price

Human Urocortin (UCN) ELISA Kit
abx574268-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Urocortin (UCN) ELISA Kit
abx574808-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Urocortin (UCN) ELISA Kit
abx574809-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Urocortin,UCN ELISA kit
ELA-E2199m	Lifescience Market	96 Tests	EUR 865

Mouse Ucn/ Urocortin ELISA Kit
E1556Mo	Sunlong	1 Kit	EUR 571

Human UCN/ Urocortin ELISA Kit
E2632Hu	Sunlong	1 Kit	EUR 571

Human UCN(Urocortin) ELISA Kit
EH2157	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: P55089 Alias: UCN(Urocortin)/UI/UROC/urocortin, preproprotein/UROCUI
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Mouse Urocortin, Ucn ELISA KIT
ELI-07053m	Lifescience Market	96 Tests	EUR 865

Human Urocortin, UCN ELISA KIT
ELI-07054h	Lifescience Market	96 Tests	EUR 824

Mouse Ucn(Urocortin) ELISA Kit
EM0739	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: P81615 Alias: Ucn/UCN(Urocortin)/UI/UROC/urocortin, preproprotein/UROCUI
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml

Human urocortin (UCN) ELISA kit
CSB-E13069h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human urocortin (UCN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human urocortin (UCN) ELISA kit
1-CSB-E13069h	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human urocortin (UCN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Urocortin(UCN) ELISA kit
CSB-EL025551MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Urocortin (UCN) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Urocortin(UCN) ELISA kit
1-CSB-EL025551MO	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Urocortin(UCN) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Ucn ORF Vector (Rat) (pORF)
ORF078579	ABM	1.0 ug DNA	EUR 506

UCN ORF Vector (Human) (pORF)
ORF014876	ABM	1.0 ug DNA	EUR 354

Ucn ORF Vector (Mouse) (pORF)
ORF060980	ABM	1.0 ug DNA	EUR 506

UCN ELISA Kit (Human) (OKAN05551)
OKAN05551	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family. The encoded preproprotein is proteolytically processed to generate the mature peptide, an endogenous ligand for both corticotropin-releasing factor receptor 1 and corticotropin-releasing factor receptor 2. In the brain this peptide may be responsible for the effects of stress on appetite. This peptide may also play a role in mood disorders, neurodegeneration, and skeletal system disorders. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin-2.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL

UCN ELISA Kit (Rat) (OKCD02957)
OKCD02957	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Acts in vitro to stimulate the secretion of adrenocorticotropic hormone (ACTH). Binds with high affinity to CRF receptor types 1, 2-alpha, and 2-beta. Plays a role in the establishment of normal hearing thresholds. Reduces food intake and regulates ghrelin levels in gastric body and plasma.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.5 pg/mL

UCN ELISA Kit (Human) (OKCD06166)
OKCD06166	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family. The encoded preproprotein is proteolytically processed to generate the mature peptide, an endogenous ligand for both corticotropin-releasing factor receptor 1 and corticotropin-releasing factor receptor 2. In the brain this peptide may be responsible for the effects of stress on appetite. This peptide may also play a role in mood disorders, neurodegeneration, and skeletal system disorders. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin-2.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL

UCN ELISA Kit (Mouse) (OKCD06167)
OKCD06167	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: This gene encodes a member of the corticotropin-releasing hormone peptide family that participates in coordinating autonomic, endocrine, and behavioral responses to stress. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone. Mice lacking the encoded protein exhibit a heightened anxiety-like behaviors and a significantly reduced acoustic startle response.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 3.4pg/mL

UCN ELISA Kit (Mouse) (OKEH03477)
OKEH03477	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Acts in vitro to stimulate the secretion of adrenocorticotropic hormone (ACTH). Binds with high affinity to CRF receptor types 1, 2-alpha, and 2-beta. Plays a role in the establishment of normal hearing thresholds (PubMed:12091910). Reduces food intake and regulates ghrelin levels in gastric body and plasma.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL

UCN ELISA Kit (Rat) (OKEH07199)
OKEH07199	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Acts in vitro to stimulate the secretion of adrenocorticotropic hormone (ACTH). Binds with high affinity to CRF receptor types 1, 2-alpha, and 2-beta. Plays a role in the establishment of normal hearing thresholds. Reduces food intake and regulates ghrelin levels in gastric body and plasma.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.77 pg/mL

Polyclonal UCN / Urocortin Antibody (aa71-120)
APR13922G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCN / Urocortin (aa71-120). This antibody is tested and proven to work in the following applications:

UCN sgRNA CRISPR Lentivector set (Human)
K2581401	ABM	3 x 1.0 ug	EUR 339

Ucn sgRNA CRISPR Lentivector set (Mouse)
K3948301	ABM	3 x 1.0 ug	EUR 339

Ucn sgRNA CRISPR Lentivector set (Rat)
K6916101	ABM	3 x 1.0 ug	EUR 339

Ucn ELISA Kit| Mouse Urocortin ELISA Kit
EF013350	Lifescience Market	96 Tests	EUR 689

UCN sgRNA CRISPR Lentivector (Human) (Target 1)
K2581402	ABM	1.0 ug DNA	EUR 154

UCN sgRNA CRISPR Lentivector (Human) (Target 2)
K2581403	ABM	1.0 ug DNA	EUR 154

UCN sgRNA CRISPR Lentivector (Human) (Target 3)
K2581404	ABM	1.0 ug DNA	EUR 154

Ucn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3948302	ABM	1.0 ug DNA	EUR 154

Ucn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3948303	ABM	1.0 ug DNA	EUR 154

Ucn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3948304	ABM	1.0 ug DNA	EUR 154

Ucn sgRNA CRISPR Lentivector (Rat) (Target 1)
K6916102	ABM	1.0 ug DNA	EUR 154

Ucn sgRNA CRISPR Lentivector (Rat) (Target 2)
K6916103	ABM	1.0 ug DNA	EUR 154

Ucn sgRNA CRISPR Lentivector (Rat) (Target 3)
K6916104	ABM	1.0 ug DNA	EUR 154

UCN Protein Vector (Human) (pPB-C-His)
PV059501	ABM	500 ng	EUR 481

UCN Protein Vector (Human) (pPB-N-His)
PV059502	ABM	500 ng	EUR 481

UCN Protein Vector (Human) (pPM-C-HA)
PV059503	ABM	500 ng	EUR 481

UCN Protein Vector (Human) (pPM-C-His)
PV059504	ABM	500 ng	EUR 481

UCN Protein Vector (Rat) (pPB-C-His)
PV314314	ABM	500 ng	EUR 603

UCN Protein Vector (Rat) (pPB-N-His)
PV314315	ABM	500 ng	EUR 603