UCN

Ucn/ Rat Ucn ELISA Kit
ELI-07052r 96 Tests
EUR 886
UCN antibody
70R-21144 50 ul
EUR 435
Description: Rabbit polyclonal UCN antibody
UCN Antibody
37061-100ul 100ul
EUR 252
UCN Antibody
CSB-PA841116-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UCN. Recognizes UCN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100
UCN Antibody
CSB-PA841116-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against UCN. Recognizes UCN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100
UCN Antibody
1-CSB-PA060039
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UCN. Recognizes UCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000
UCN Antibody
1-CSB-PA254368
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCN. Recognizes UCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
UCN-01
C4783-1 1 mg
EUR 266
UCN-02
C4829-1 1 mg
EUR 460
Description: UCN-02 is a derivative of staurosporine and a stereoisomer of UCN-01, which has been first isolated from a high staurosporine-producing Streptomyces culture as a minor co-metabolite [1]. UCN-02 is protein kinase C inhibitor [1].
UCN-02
C4829-5 5 mg
EUR 1488
Description: UCN-02 is a derivative of staurosporine and a stereoisomer of UCN-01, which has been first isolated from a high staurosporine-producing Streptomyces culture as a minor co-metabolite [1]. UCN-02 is protein kinase C inhibitor [1].
UCN Antibody
1-CSB-PA025551GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UCN. Recognizes UCN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
UCN-02
HY-108262 1mg
EUR 727
UCN-01
U005-1MG 1 mg
EUR 355
UCN-01
U005-5MG 5 mg
EUR 1167
UCN-02
U006-1MG 1 mg
EUR 331
UCN-02
U006-5MG 5 mg
EUR 1082
Urocortin (UCN) Antibody
20-abx116545
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Urocortin (UCN) Antibody
20-abx013246
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Urocortin (UCN) Antibody
abx239291-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Urocortin (UCN) Antibody
20-abx241444
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
UCN Conjugated Antibody
C37061 100ul
EUR 397
Urocortin (UCN) Antibody
abx331335-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Urocortin (UCN) Antibody
20-abx326440
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UCN cloning plasmid
CSB-CL025551HU-10ug 10ug
EUR 215
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 375
  • Sequence: ATGAGGCAGGCGGGACGCGCAGCGCTGCTGGCCGCGCTGCTGCTCCTGGTACAGCTGTGCCCTGGGAGCAGCCAGAGGAGCCCCGAGGCGGCCGGGGTCCAGGACCCGAGTCTGCGCTGGAGCCCCGGGGCACGGAACCAGGGTGGCGGGGCCCGCGCGCTCCTCTTGCTGCTGGC
  • Show more
Description: A cloning plasmid for the UCN gene.
Human UCN ELISA Kit
ELA-E2199h 96 Tests
EUR 824
UCN ELISA KIT|Human
EF006232 96 Tests
EUR 689
Mouse UCN shRNA Plasmid
20-abx973300
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat UCN shRNA Plasmid
20-abx985316
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human UCN shRNA Plasmid
20-abx955024
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UCN Recombinant Protein (Rat)
RP235733 100 ug Ask for price
UCN Recombinant Protein (Human)
RP044626 100 ug Ask for price
UCN Recombinant Protein (Mouse)
RP182936 100 ug Ask for price
Mouse Urocortin(UCN) ELISA kit
CSB-EL025551MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Urocortin (UCN) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Urocortin(UCN) ELISA kit
1-CSB-EL025551MO
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Urocortin(UCN) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Mouse Urocortin,UCN ELISA kit
ELA-E2199m 96 Tests
EUR 865
Mouse Ucn/ Urocortin ELISA Kit
E1556Mo 1 Kit
EUR 571
Human UCN/ Urocortin ELISA Kit
E2632Hu 1 Kit
EUR 571
Human UCN(Urocortin) ELISA Kit
EH2157 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: P55089
  • Alias: UCN(Urocortin)/UI/UROC/urocortin, preproprotein/UROCUI
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml
Mouse Urocortin, Ucn ELISA KIT
ELI-07053m 96 Tests
EUR 865
Human Urocortin, UCN ELISA KIT
ELI-07054h 96 Tests
EUR 824
Human urocortin (UCN) ELISA kit
CSB-E13069h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human urocortin (UCN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human urocortin (UCN) ELISA kit
1-CSB-E13069h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human urocortin (UCN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Urocortin (UCN) ELISA Kit
abx574268-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Urocortin (UCN) ELISA Kit
abx574808-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Urocortin (UCN) ELISA Kit
abx574809-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Ucn(Urocortin) ELISA Kit
EM0739 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: P81615
  • Alias: Ucn/UCN(Urocortin)/UI/UROC/urocortin, preproprotein/UROCUI
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 9.375pg/ml
Ucn ORF Vector (Mouse) (pORF)
ORF060980 1.0 ug DNA
EUR 506
Ucn ORF Vector (Rat) (pORF)
ORF078579 1.0 ug DNA
EUR 506
UCN ORF Vector (Human) (pORF)
ORF014876 1.0 ug DNA
EUR 354
UCN ELISA Kit (Human) (OKAN05551)
OKAN05551 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family. The encoded preproprotein is proteolytically processed to generate the mature peptide, an endogenous ligand for both corticotropin-releasing factor receptor 1 and corticotropin-releasing factor receptor 2. In the brain this peptide may be responsible for the effects of stress on appetite. This peptide may also play a role in mood disorders, neurodegeneration, and skeletal system disorders. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin-2.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.0 pg/mL
UCN ELISA Kit (Rat) (OKCD02957)
OKCD02957 96 Wells
EUR 818
Description: Description of target: Acts in vitro to stimulate the secretion of adrenocorticotropic hormone (ACTH). Binds with high affinity to CRF receptor types 1, 2-alpha, and 2-beta. Plays a role in the establishment of normal hearing thresholds. Reduces food intake and regulates ghrelin levels in gastric body and plasma.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.5 pg/mL
UCN ELISA Kit (Human) (OKCD06166)
OKCD06166 96 Wells
EUR 753
Description: Description of target: This gene encodes a member of the sauvagine/corticotropin-releasing factor/urotensin I family. The encoded preproprotein is proteolytically processed to generate the mature peptide, an endogenous ligand for both corticotropin-releasing factor receptor 1 and corticotropin-releasing factor receptor 2. In the brain this peptide may be responsible for the effects of stress on appetite. This peptide may also play a role in mood disorders, neurodegeneration, and skeletal system disorders. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin-2.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.0pg/mL
UCN ELISA Kit (Mouse) (OKCD06167)
OKCD06167 96 Wells
EUR 1001
Description: Description of target: This gene encodes a member of the corticotropin-releasing hormone peptide family that participates in coordinating autonomic, endocrine, and behavioral responses to stress. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone. Mice lacking the encoded protein exhibit a heightened anxiety-like behaviors and a significantly reduced acoustic startle response.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 3.4pg/mL
UCN ELISA Kit (Rat) (OKEH07199)
OKEH07199 96 Wells
EUR 662
Description: Description of target: Acts in vitro to stimulate the secretion of adrenocorticotropic hormone (ACTH). Binds with high affinity to CRF receptor types 1, 2-alpha, and 2-beta. Plays a role in the establishment of normal hearing thresholds. Reduces food intake and regulates ghrelin levels in gastric body and plasma.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.77 pg/mL
UCN ELISA Kit (Mouse) (OKEH03477)
OKEH03477 96 Wells
EUR 662
Description: Description of target: Acts in vitro to stimulate the secretion of adrenocorticotropic hormone (ACTH). Binds with high affinity to CRF receptor types 1, 2-alpha, and 2-beta. Plays a role in the establishment of normal hearing thresholds (PubMed:12091910). Reduces food intake and regulates ghrelin levels in gastric body and plasma.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.8 pg/mL
Polyclonal UCN / Urocortin Antibody (aa71-120)
APR13922G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCN / Urocortin (aa71-120). This antibody is tested and proven to work in the following applications:
Ucn sgRNA CRISPR Lentivector set (Rat)
K6916101 3 x 1.0 ug
EUR 339
UCN sgRNA CRISPR Lentivector set (Human)
K2581401 3 x 1.0 ug
EUR 339
Ucn sgRNA CRISPR Lentivector set (Mouse)
K3948301 3 x 1.0 ug
EUR 339
Ucn ELISA Kit| Mouse Urocortin ELISA Kit
EF013350 96 Tests
EUR 689
Ucn sgRNA CRISPR Lentivector (Rat) (Target 1)
K6916102 1.0 ug DNA
EUR 154
Ucn sgRNA CRISPR Lentivector (Rat) (Target 2)
K6916103 1.0 ug DNA
EUR 154
Ucn sgRNA CRISPR Lentivector (Rat) (Target 3)
K6916104 1.0 ug DNA
EUR 154
UCN sgRNA CRISPR Lentivector (Human) (Target 1)
K2581402 1.0 ug DNA
EUR 154
UCN sgRNA CRISPR Lentivector (Human) (Target 2)
K2581403 1.0 ug DNA
EUR 154
UCN sgRNA CRISPR Lentivector (Human) (Target 3)
K2581404 1.0 ug DNA
EUR 154
Ucn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3948302 1.0 ug DNA
EUR 154
Ucn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3948303 1.0 ug DNA
EUR 154
Ucn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3948304 1.0 ug DNA
EUR 154
UCN Protein Vector (Mouse) (pPB-C-His)
PV243918 500 ng
EUR 603
UCN Protein Vector (Mouse) (pPB-N-His)
PV243919 500 ng
EUR 603
UCN Protein Vector (Mouse) (pPM-C-HA)
PV243920 500 ng
EUR 603
UCN Protein Vector (Mouse) (pPM-C-His)
PV243921 500 ng
EUR 603
UCN Protein Vector (Rat) (pPB-C-His)
PV314314 500 ng
EUR 603
UCN Protein Vector (Rat) (pPB-N-His)
PV314315 500 ng
EUR 603