  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA21726 50 ul
EUR 363
Description: Mouse polyclonal to WDR20
YF-PA21727 50 ug
EUR 363
Description: Mouse polyclonal to WDR20
YF-PA21728 100 ul
EUR 403
Description: Rabbit polyclonal to WDR20
WDR20 cloning plasmid
CSB-CL823451HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atggcgacggagggaggagggaaggagatgaacgagattaagacccaattcaccacccgggaaggtctgtacaagctgctgccgcactcggagtacagccggcccaaccgggtgcccttcaactcgcagggatccaaccctgtccgcgtctccttcgtaaacctcaacgaccagtc
  • Show more
Description: A cloning plasmid for the WDR20 gene.
WDR20 cloning plasmid
CSB-CL823451HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1710
  • Sequence: atggcgacggagggaggagggaaggagatgaacgagattaagacccaattcaccacccgggaaggtctgtacaagctgctgccgcactcggagtacagccggcccaaccgggtgcccttcaactcgcagggatccaaccctgtccgcgtctccttcgtaaacctcaacgaccagt
  • Show more
Description: A cloning plasmid for the WDR20 gene.
anti- WDR20 antibody
FNab09486 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: WD repeat domain 20
  • Uniprot ID: Q8TBZ3
  • Gene ID: 91833
  • Research Area: Epigenetics
Description: Antibody raised against WDR20
Anti-WDR20 antibody
PAab09486 100 ug
EUR 412
Anti-WDR20 (2A6)
YF-MA11715 100 ug
EUR 363
Description: Mouse monoclonal to WDR20
Anti-WDR20 (1D10)
YF-MA19652 100 ug
EUR 363
Description: Mouse monoclonal to WDR20
EF004268 96 Tests
EUR 689
Mouse WDR20 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human WDR20 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
WDR20 Recombinant Protein (Human)
RP034579 100 ug Ask for price
WDR20 Recombinant Protein (Human)
RP034582 100 ug Ask for price
WDR20 ORF Vector (Human) (pORF)
ORF011527 1.0 ug DNA
EUR 95
WDR20 ORF Vector (Human) (pORF)
ORF011528 1.0 ug DNA
EUR 95
WDR20 sgRNA CRISPR Lentivector set (Human)
K2629701 3 x 1.0 ug
EUR 339
WD Repeat-Containing Protein 20 (WDR20) Antibody
abx029810-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
WD Repeat-Containing Protein 20 (WDR20) Antibody
abx029810-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
WD Repeat-Containing Protein 20 (WDR20) Antibody
abx239486-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
WDR20 sgRNA CRISPR Lentivector (Human) (Target 1)
K2629702 1.0 ug DNA
EUR 154
WDR20 sgRNA CRISPR Lentivector (Human) (Target 2)
K2629703 1.0 ug DNA
EUR 154
WDR20 sgRNA CRISPR Lentivector (Human) (Target 3)
K2629704 1.0 ug DNA
EUR 154
WDR20 Protein Vector (Human) (pPB-C-His)
PV046105 500 ng
EUR 329
WDR20 Protein Vector (Human) (pPB-N-His)
PV046106 500 ng
EUR 329
WDR20 Protein Vector (Human) (pPM-C-HA)
PV046107 500 ng
EUR 329
WDR20 Protein Vector (Human) (pPM-C-His)
PV046108 500 ng
EUR 329
WDR20 Protein Vector (Human) (pPB-C-His)
PV046109 500 ng
EUR 329
WDR20 Protein Vector (Human) (pPB-N-His)
PV046110 500 ng
EUR 329
WDR20 Protein Vector (Human) (pPM-C-HA)
PV046111 500 ng
EUR 329
WDR20 Protein Vector (Human) (pPM-C-His)
PV046112 500 ng
EUR 329
WDR20 3'UTR GFP Stable Cell Line
TU078406 1.0 ml
EUR 1521
WDR20 3'UTR Luciferase Stable Cell Line
TU028406 1.0 ml
EUR 1521
WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV716763 1.0 ug DNA
EUR 316
WDR20 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV716767 1.0 ug DNA
EUR 316
WDR20 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV716768 1.0 ug DNA
EUR 316
Human WD repeat- containing protein 20, WDR20 ELISA KIT
ELI-16960h 96 Tests
EUR 824
Mouse WD repeat- containing protein 20, Wdr20 ELISA KIT
ELI-51469m 96 Tests
EUR 865
Human WD repeat-containing protein 20 (WDR20) ELISA Kit
abx384285-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2629705 3 x 1.0 ug
EUR 376
WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV716764 1.0 ug DNA
EUR 316
WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV716765 1.0 ug DNA
EUR 374
WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV716766 1.0 ug DNA
EUR 374
WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2629706 1.0 ug DNA
EUR 167
WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2629707 1.0 ug DNA
EUR 167
WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2629708 1.0 ug DNA
EUR 167