WDR20

WDR20 siRNA
20-abx939695	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-WDR20
YF-PA21726	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to WDR20

anti-WDR20
YF-PA21727	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to WDR20

anti-WDR20
YF-PA21728	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to WDR20

WDR20 cloning plasmid
CSB-CL823451HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 588 Sequence: atggcgacggagggaggagggaaggagatgaacgagattaagacccaattcaccacccgggaaggtctgtacaagctgctgccgcactcggagtacagccggcccaaccgggtgcccttcaactcgcagggatccaaccctgtccgcgtctccttcgtaaacctcaacgaccagtc Show more
Description: A cloning plasmid for the WDR20 gene.

WDR20 cloning plasmid
CSB-CL823451HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1710 Sequence: atggcgacggagggaggagggaaggagatgaacgagattaagacccaattcaccacccgggaaggtctgtacaagctgctgccgcactcggagtacagccggcccaaccgggtgcccttcaactcgcagggatccaaccctgtccgcgtctccttcgtaaacctcaacgaccagt Show more
Description: A cloning plasmid for the WDR20 gene.

anti- WDR20 antibody
FNab09486	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:5000 Immunogen: WD repeat domain 20 Uniprot ID: Q8TBZ3 Gene ID: 91833 Research Area: Epigenetics
Description: Antibody raised against WDR20

Anti-WDR20 antibody
PAab09486	Lifescience Market	100 ug	EUR 412

Anti-WDR20 (2A6)
YF-MA11715	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to WDR20

Anti-WDR20 (1D10)
YF-MA19652	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to WDR20

WDR20 ELISA KIT|Human
EF004268	Lifescience Market	96 Tests	EUR 689

Mouse WDR20 shRNA Plasmid
20-abx977330	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human WDR20 shRNA Plasmid
20-abx964083	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

WDR20 Recombinant Protein (Human)
RP034579	ABM	100 ug	Ask for price

WDR20 Recombinant Protein (Human)
RP034582	ABM	100 ug	Ask for price

WDR20 ORF Vector (Human) (pORF)
ORF011527	ABM	1.0 ug DNA	EUR 95

WDR20 ORF Vector (Human) (pORF)
ORF011528	ABM	1.0 ug DNA	EUR 95

WDR20 sgRNA CRISPR Lentivector set (Human)
K2629701	ABM	3 x 1.0 ug	EUR 339

WD Repeat-Containing Protein 20 (WDR20) Antibody
abx029810-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

WD Repeat-Containing Protein 20 (WDR20) Antibody
abx029810-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

WD Repeat-Containing Protein 20 (WDR20) Antibody
abx239486-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

WDR20 sgRNA CRISPR Lentivector (Human) (Target 1)
K2629702	ABM	1.0 ug DNA	EUR 154

WDR20 sgRNA CRISPR Lentivector (Human) (Target 2)
K2629703	ABM	1.0 ug DNA	EUR 154

WDR20 sgRNA CRISPR Lentivector (Human) (Target 3)
K2629704	ABM	1.0 ug DNA	EUR 154

WDR20 Protein Vector (Human) (pPB-C-His)
PV046105	ABM	500 ng	EUR 329

WDR20 Protein Vector (Human) (pPB-N-His)
PV046106	ABM	500 ng	EUR 329

WDR20 Protein Vector (Human) (pPM-C-HA)
PV046107	ABM	500 ng	EUR 329

WDR20 Protein Vector (Human) (pPM-C-His)
PV046108	ABM	500 ng	EUR 329

WDR20 Protein Vector (Human) (pPB-C-His)
PV046109	ABM	500 ng	EUR 329

WDR20 Protein Vector (Human) (pPB-N-His)
PV046110	ABM	500 ng	EUR 329

WDR20 Protein Vector (Human) (pPM-C-HA)
PV046111	ABM	500 ng	EUR 329

WDR20 Protein Vector (Human) (pPM-C-His)
PV046112	ABM	500 ng	EUR 329

WDR20 3'UTR GFP Stable Cell Line
TU078406	ABM	1.0 ml	EUR 1521

WDR20 3'UTR Luciferase Stable Cell Line
TU028406	ABM	1.0 ml	EUR 1521

WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV716763	ABM	1.0 ug DNA	EUR 316

WDR20 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV716767	ABM	1.0 ug DNA	EUR 316

WDR20 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV716768	ABM	1.0 ug DNA	EUR 316

Human WD repeat- containing protein 20, WDR20 ELISA KIT
ELI-16960h	Lifescience Market	96 Tests	EUR 824

Mouse WD repeat- containing protein 20, Wdr20 ELISA KIT
ELI-51469m	Lifescience Market	96 Tests	EUR 865

Human WD repeat-containing protein 20 (WDR20) ELISA Kit
abx384285-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2629705	ABM	3 x 1.0 ug	EUR 376

WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV716764	ABM	1.0 ug DNA	EUR 316

WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV716765	ABM	1.0 ug DNA	EUR 374

WDR20 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV716766	ABM	1.0 ug DNA	EUR 374

WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2629706	ABM	1.0 ug DNA	EUR 167

WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2629707	ABM	1.0 ug DNA	EUR 167

WDR20 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2629708	ABM	1.0 ug DNA	EUR 167