YKT6

Ykt6/ Rat Ykt6 ELISA Kit
ELI-35246r 96 Tests
EUR 886.00
Synaptobrevin Homolog YKT6 (YKT6) Antibody (HRP)
20-abx305959
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Synaptobrevin Homolog YKT6 (YKT6) Antibody (FITC)
20-abx305960
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Synaptobrevin Homolog YKT6 (YKT6) Antibody (Biotin)
20-abx305961
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
YKT6 Antibody
1-CSB-PA026265LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YKT6. Recognizes YKT6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
YKT6 siRNA
20-abx906128
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YKT6 siRNA
20-abx940096
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YKT6 siRNA
20-abx940097
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Bovine Synaptobrevin homolog YKT6, YKT6 ELISA KIT
ELI-17416b 96 Tests
EUR 928.00
Human Synaptobrevin homolog YKT6, YKT6 ELISA KIT
ELI-40245h 96 Tests
EUR 824.00
Mouse Synaptobrevin homolog YKT6, Ykt6 ELISA KIT
ELI-40489m 96 Tests
EUR 865.00
YKT6 cloning plasmid
CSB-CL026265HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 597
  • Sequence: atgaagctgtacagcctcagcgtcctctacaaaggcgaggccaaggtggtgctgctcaaagccgcatacgatgtgtcttccttcagctttttccagagatccagcgttcaggaattcatgaccttcacgagtcaactgattgtggagcgctcatcgaaaggcactagagcttctgt
  • Show more
Description: A cloning plasmid for the YKT6 gene.
YKT6 Polyclonal Antibody
29971-100ul 100ul
EUR 252.00
YKT6 Polyclonal Antibody
29971-50ul 50ul
EUR 187.00
YKT6 Polyclonal Antibody
29972-100ul 100ul
EUR 252.00
YKT6 Polyclonal Antibody
29972-50ul 50ul
EUR 187.00
YKT6 Polyclonal Antibody
A61822 100 µg
EUR 570.55
Description: The best epigenetics products
YKT6 Rabbit pAb
A17083-100ul 100 ul
EUR 308.00
YKT6 Rabbit pAb
A17083-200ul 200 ul
EUR 459.00
YKT6 Rabbit pAb
A17083-20ul 20 ul
EUR 183.00
YKT6 Rabbit pAb
A17083-50ul 50 ul
EUR 223.00
YKT6 Rabbit pAb
A17084-100ul 100 ul
EUR 308.00
YKT6 Rabbit pAb
A17084-200ul 200 ul
EUR 459.00
YKT6 Rabbit pAb
A17084-20ul 20 ul
EUR 183.00
YKT6 Rabbit pAb
A17084-50ul 50 ul
EUR 223.00
Anti-YKT6 antibody
STJ119338 100 µl
EUR 277.00
Anti-YKT6 antibody
STJ119339 100 µl
EUR 277.00
Anti-YKT6 (1F8)
YF-MA17419 100 ug
EUR 363.00
Description: Mouse monoclonal to YKT6
YKT6 Polyclonal Conjugated Antibody
C29971 100ul
EUR 397.00
YKT6 Polyclonal Conjugated Antibody
C29972 100ul
EUR 397.00
Rat YKT6 shRNA Plasmid
20-abx986213
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse YKT6 shRNA Plasmid
20-abx974758
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
YKT6 Antibody, HRP conjugated
1-CSB-PA026265LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YKT6. Recognizes YKT6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
YKT6 Antibody, FITC conjugated
1-CSB-PA026265LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YKT6. Recognizes YKT6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
YKT6 Antibody, Biotin conjugated
1-CSB-PA026265LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YKT6. Recognizes YKT6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human YKT6 shRNA Plasmid
20-abx957260
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
YKT6 Recombinant Protein (Rat)
RP237746 100 ug Ask for price
YKT6 Recombinant Protein (Human)
RP035038 100 ug Ask for price
YKT6 Recombinant Protein (Mouse)
RP186044 100 ug Ask for price
YKT6 Polyclonal Antibody, Biotin Conjugated
A61823 100 µg
EUR 570.55
Description: kits suitable for this type of research
YKT6 Polyclonal Antibody, FITC Conjugated
A61824 100 µg
EUR 570.55
Description: fast delivery possible
YKT6 Polyclonal Antibody, HRP Conjugated
A61825 100 µg
EUR 570.55
Description: reagents widely cited
YKT6 ORF Vector (Human) (pORF)
ORF011680 1.0 ug DNA
EUR 95.00
Ykt6 ORF Vector (Mouse) (pORF)
ORF062016 1.0 ug DNA
EUR 506.00
Ykt6 ORF Vector (Rat) (pORF)
ORF079250 1.0 ug DNA
EUR 506.00
Ykt6 sgRNA CRISPR Lentivector set (Rat)
K7027601 3 x 1.0 ug
EUR 339.00
Ykt6 sgRNA CRISPR Lentivector set (Mouse)
K3483201 3 x 1.0 ug
EUR 339.00
YKT6 sgRNA CRISPR Lentivector set (Human)
K2655301 3 x 1.0 ug
EUR 339.00
Ykt6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7027602 1.0 ug DNA
EUR 154.00
Ykt6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7027603 1.0 ug DNA
EUR 154.00
Ykt6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7027604 1.0 ug DNA
EUR 154.00
Ykt6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3483202 1.0 ug DNA
EUR 154.00
Ykt6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3483203 1.0 ug DNA
EUR 154.00
Ykt6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3483204 1.0 ug DNA
EUR 154.00
YKT6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2655302 1.0 ug DNA
EUR 154.00
YKT6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2655303 1.0 ug DNA
EUR 154.00
YKT6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2655304 1.0 ug DNA
EUR 154.00
YKT6 Protein Vector (Human) (pPB-C-His)
PV046717 500 ng
EUR 329.00
YKT6 Protein Vector (Human) (pPB-N-His)
PV046718 500 ng
EUR 329.00
YKT6 Protein Vector (Human) (pPM-C-HA)
PV046719 500 ng
EUR 329.00
YKT6 Protein Vector (Human) (pPM-C-His)
PV046720 500 ng
EUR 329.00
YKT6 Protein Vector (Rat) (pPB-C-His)
PV316998 500 ng
EUR 603.00
YKT6 Protein Vector (Rat) (pPB-N-His)
PV316999 500 ng
EUR 603.00
YKT6 Protein Vector (Rat) (pPM-C-HA)
PV317000 500 ng
EUR 603.00
YKT6 Protein Vector (Rat) (pPM-C-His)
PV317001 500 ng
EUR 603.00
YKT6 Protein Vector (Mouse) (pPB-C-His)
PV248062 500 ng
EUR 603.00
YKT6 Protein Vector (Mouse) (pPB-N-His)
PV248063 500 ng
EUR 603.00
YKT6 Protein Vector (Mouse) (pPM-C-HA)
PV248064 500 ng
EUR 603.00
YKT6 Protein Vector (Mouse) (pPM-C-His)
PV248065 500 ng
EUR 603.00
Ykt6 3'UTR Luciferase Stable Cell Line
TU223516 1.0 ml Ask for price
Ykt6 3'UTR Luciferase Stable Cell Line
TU122431 1.0 ml Ask for price
YKT6 3'UTR GFP Stable Cell Line
TU078652 1.0 ml
EUR 1521.00
YKT6 3'UTR Luciferase Stable Cell Line
TU028652 1.0 ml
EUR 1521.00
Ykt6 3'UTR GFP Stable Cell Line
TU172431 1.0 ml Ask for price
Ykt6 3'UTR GFP Stable Cell Line
TU273516 1.0 ml Ask for price