YKT6

Ykt6/ Rat Ykt6 ELISA Kit
ELI-35246r	Lifescience Market	96 Tests	EUR 886

Synaptobrevin Homolog YKT6 (YKT6) Antibody (HRP)
20-abx305959	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Synaptobrevin Homolog YKT6 (YKT6) Antibody (FITC)
20-abx305960	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Synaptobrevin Homolog YKT6 (YKT6) Antibody (Biotin)
20-abx305961	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

YKT6 Antibody
1-CSB-PA026265LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YKT6. Recognizes YKT6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

YKT6 siRNA
20-abx906128	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

YKT6 siRNA
20-abx940096	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

YKT6 siRNA
20-abx940097	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Bovine Synaptobrevin homolog YKT6, YKT6 ELISA KIT
ELI-17416b	Lifescience Market	96 Tests	EUR 928

Human Synaptobrevin homolog YKT6, YKT6 ELISA KIT
ELI-40245h	Lifescience Market	96 Tests	EUR 824

Mouse Synaptobrevin homolog YKT6, Ykt6 ELISA KIT
ELI-40489m	Lifescience Market	96 Tests	EUR 865

YKT6 Polyclonal Antibody
29971-100ul	SAB	100ul	EUR 252

YKT6 Polyclonal Antibody
29971-50ul	SAB	50ul	EUR 187

YKT6 Polyclonal Antibody
29972-100ul	SAB	100ul	EUR 252

YKT6 Polyclonal Antibody
29972-50ul	SAB	50ul	EUR 187

YKT6 cloning plasmid
CSB-CL026265HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 597 Sequence: atgaagctgtacagcctcagcgtcctctacaaaggcgaggccaaggtggtgctgctcaaagccgcatacgatgtgtcttccttcagctttttccagagatccagcgttcaggaattcatgaccttcacgagtcaactgattgtggagcgctcatcgaaaggcactagagcttctgt Show more
Description: A cloning plasmid for the YKT6 gene.

YKT6 Polyclonal Antibody
A61822	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

YKT6 Rabbit pAb
A17083-100ul	Abclonal	100 ul	EUR 308

YKT6 Rabbit pAb
A17083-200ul	Abclonal	200 ul	EUR 459

YKT6 Rabbit pAb
A17083-20ul	Abclonal	20 ul	EUR 183

YKT6 Rabbit pAb
A17083-50ul	Abclonal	50 ul	EUR 223

YKT6 Rabbit pAb
A17084-100ul	Abclonal	100 ul	EUR 308

YKT6 Rabbit pAb
A17084-200ul	Abclonal	200 ul	EUR 459

YKT6 Rabbit pAb
A17084-20ul	Abclonal	20 ul	EUR 183

YKT6 Rabbit pAb
A17084-50ul	Abclonal	50 ul	EUR 223

Anti-YKT6 antibody
STJ119338	St John's Laboratory	100 µl	EUR 277

Anti-YKT6 antibody
STJ119339	St John's Laboratory	100 µl	EUR 277

Anti-YKT6 (1F8)
YF-MA17419	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to YKT6

YKT6 Antibody, HRP conjugated
1-CSB-PA026265LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YKT6. Recognizes YKT6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

YKT6 Antibody, FITC conjugated
1-CSB-PA026265LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YKT6. Recognizes YKT6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

YKT6 Antibody, Biotin conjugated
1-CSB-PA026265LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against YKT6. Recognizes YKT6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse YKT6 shRNA Plasmid
20-abx974758	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat YKT6 shRNA Plasmid
20-abx986213	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

YKT6 Polyclonal Conjugated Antibody
C29971	SAB	100ul	EUR 397

YKT6 Polyclonal Conjugated Antibody
C29972	SAB	100ul	EUR 397

Human YKT6 shRNA Plasmid
20-abx957260	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

YKT6 Recombinant Protein (Rat)
RP237746	ABM	100 ug	Ask for price

YKT6 Recombinant Protein (Human)
RP035038	ABM	100 ug	Ask for price

YKT6 Recombinant Protein (Mouse)
RP186044	ABM	100 ug	Ask for price

YKT6 Polyclonal Antibody, Biotin Conjugated
A61823	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

YKT6 Polyclonal Antibody, FITC Conjugated
A61824	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

YKT6 Polyclonal Antibody, HRP Conjugated
A61825	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Ykt6 ORF Vector (Mouse) (pORF)
ORF062016	ABM	1.0 ug DNA	EUR 506

Ykt6 ORF Vector (Rat) (pORF)
ORF079250	ABM	1.0 ug DNA	EUR 506

YKT6 ORF Vector (Human) (pORF)
ORF011680	ABM	1.0 ug DNA	EUR 95

Ykt6 sgRNA CRISPR Lentivector set (Rat)
K7027601	ABM	3 x 1.0 ug	EUR 339

YKT6 sgRNA CRISPR Lentivector set (Human)
K2655301	ABM	3 x 1.0 ug	EUR 339

Ykt6 sgRNA CRISPR Lentivector set (Mouse)
K3483201	ABM	3 x 1.0 ug	EUR 339

Ykt6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7027602	ABM	1.0 ug DNA	EUR 154

Ykt6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7027603	ABM	1.0 ug DNA	EUR 154

Ykt6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7027604	ABM	1.0 ug DNA	EUR 154

YKT6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2655302	ABM	1.0 ug DNA	EUR 154

YKT6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2655303	ABM	1.0 ug DNA	EUR 154

YKT6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2655304	ABM	1.0 ug DNA	EUR 154

Ykt6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3483202	ABM	1.0 ug DNA	EUR 154

Ykt6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3483203	ABM	1.0 ug DNA	EUR 154

Ykt6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3483204	ABM	1.0 ug DNA	EUR 154

YKT6 Protein Vector (Mouse) (pPB-C-His)
PV248062	ABM	500 ng	EUR 603

YKT6 Protein Vector (Mouse) (pPB-N-His)
PV248063	ABM	500 ng	EUR 603

YKT6 Protein Vector (Mouse) (pPM-C-HA)
PV248064	ABM	500 ng	EUR 603

YKT6 Protein Vector (Mouse) (pPM-C-His)
PV248065	ABM	500 ng	EUR 603

YKT6 Protein Vector (Rat) (pPB-C-His)
PV316998	ABM	500 ng	EUR 603

YKT6 Protein Vector (Rat) (pPB-N-His)
PV316999	ABM	500 ng	EUR 603

YKT6 Protein Vector (Rat) (pPM-C-HA)
PV317000	ABM	500 ng	EUR 603

YKT6 Protein Vector (Rat) (pPM-C-His)
PV317001	ABM	500 ng	EUR 603

YKT6 Protein Vector (Human) (pPB-C-His)
PV046717	ABM	500 ng	EUR 329

YKT6 Protein Vector (Human) (pPB-N-His)
PV046718	ABM	500 ng	EUR 329

YKT6 Protein Vector (Human) (pPM-C-HA)
PV046719	ABM	500 ng	EUR 329

YKT6 Protein Vector (Human) (pPM-C-His)
PV046720	ABM	500 ng	EUR 329

Ykt6 3'UTR Luciferase Stable Cell Line
TU122431	ABM	1.0 ml	Ask for price

YKT6 3'UTR GFP Stable Cell Line
TU078652	ABM	1.0 ml	EUR 1521

Ykt6 3'UTR GFP Stable Cell Line
TU172431	ABM	1.0 ml	Ask for price

Ykt6 3'UTR Luciferase Stable Cell Line
TU223516	ABM	1.0 ml	Ask for price

YKT6 3'UTR Luciferase Stable Cell Line
TU028652	ABM	1.0 ml	EUR 1521

Ykt6 3'UTR GFP Stable Cell Line
TU273516	ABM	1.0 ml	Ask for price