ALG13

ALG13 antibody

70R-15679 50 ul
EUR 435.00
Description: Rabbit polyclonal ALG13 antibody

ALG13 Antibody

1-CSB-PA001598GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ALG13. Recognizes ALG13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

ALG13 Antibody

1-CSB-PA885677LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALG13. Recognizes ALG13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

ALG13 siRNA

20-abx900285
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ALG13 siRNA

20-abx907269
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ALG13 siRNA

20-abx907270
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ALG13, UDP-N-Acetylglucosaminyltransferase Subunit (ALG13) Antibody

20-abx111091
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ALG13, UDP-N-Acetylglucosaminyltransferase Subunit (ALG13) Antibody

20-abx301044
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

ALG13, UDP-N-Acetylglucosaminyltransferase Subunit (ALG13) Antibody

abx230306-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

ALG13, UDP-N-Acetylglucosaminyltransferase Subunit (ALG13) Antibody (HRP)

20-abx315529
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

ALG13, UDP-N-Acetylglucosaminyltransferase Subunit (ALG13) Antibody (FITC)

20-abx315530
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

ALG13, UDP-N-Acetylglucosaminyltransferase Subunit (ALG13) Antibody (Biotin)

20-abx315531
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

ALG13 Polyclonal Antibody

30311-100ul 100ul
EUR 252.00

ALG13 Polyclonal Antibody

30311-50ul 50ul
EUR 187.00

ALG13 cloning plasmid

CSB-CL885677HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 498
  • Sequence: atgaagtgcgtgtttgttaccgtagggaccaccagctttgacgacctcattgcgtgtgtgtcggcgcccgacagtctgcaaaaaatcgagagccttggttacaaccgacttatcctgcaaattggtagaggaacggtggtacctgaacccttcagtactgagtcgtttactctgga
  • Show more
Description: A cloning plasmid for the ALG13 gene.

ALG13 cloning plasmid

CSB-CL885677HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1380
  • Sequence: atgactatggcttacggcaagggagaccccctcctcccacccaggctgcagcacagtatgcattatgggcacgatcctccaatgcactactcacagacagctggcaatgttatgtctaatgaacattttcatcctcagcatccatctccgagacaaggtcggggatatgggatgc
  • Show more
Description: A cloning plasmid for the ALG13 gene.

ALG13 Rabbit pAb

A18115-100ul 100 ul
EUR 308.00

ALG13 Rabbit pAb

A18115-200ul 200 ul
EUR 459.00

ALG13 Rabbit pAb

A18115-20ul 20 ul
EUR 183.00

ALG13 Rabbit pAb

A18115-50ul 50 ul
EUR 223.00

anti- ALG13 antibody

FNab00306 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:10000
  • IHC: 1:20-1:200
  • Immunogen: asparagine-linked glycosylation 13 homolog(S. cerevisiae)
  • Uniprot ID: Q9NP73
  • Gene ID: 79868
  • Research Area: Metabolism
Description: Antibody raised against ALG13

Anti-ALG13 antibody

PAab00306 100 ug
EUR 355.00

Anti-ALG13 antibody

STJ11100086 100 µl
EUR 277.00

Human ALG13, UDP-N-Acetylglucosaminyltransferase Subunit (ALG13) ELISA Kit

abx385711-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

ALG13 Antibody, HRP conjugated

1-CSB-PA885677LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALG13. Recognizes ALG13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ALG13 Antibody, FITC conjugated

1-CSB-PA885677LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALG13. Recognizes ALG13 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ALG13 Antibody, Biotin conjugated

1-CSB-PA885677LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALG13. Recognizes ALG13 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALG13 ELISA KIT|Human

EF007715 96 Tests
EUR 689.00

Rat ALG13 shRNA Plasmid

20-abx989047
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse ALG13 shRNA Plasmid

20-abx976217
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

ALG13 Polyclonal Conjugated Antibody

C30311 100ul
EUR 397.00

Human ALG13 shRNA Plasmid

20-abx962625
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse Alg13 ELISA KIT

ELI-34573m 96 Tests
EUR 865.00

Human ALG13 ELISA KIT

ELI-49241h 96 Tests
EUR 824.00

ALG13 Recombinant Protein (Human)

RP001024 100 ug Ask for price

ALG13 Recombinant Protein (Human)

RP036562 100 ug Ask for price

ALG13 Recombinant Protein (Mouse)

RP115397 100 ug Ask for price

ALG13 Recombinant Protein (Rat)

RP189917 100 ug Ask for price

Alg13 ORF Vector (Rat) (pORF)

ORF063307 1.0 ug DNA
EUR 506.00

ALG13 ORF Vector (Human) (pORF)

ORF000342 1.0 ug DNA
EUR 95.00

ALG13 ORF Vector (Human) (pORF)

ORF012188 1.0 ug DNA
EUR 354.00

Alg13 ORF Vector (Mouse) (pORF)

ORF038467 1.0 ug DNA
EUR 506.00

pECMV-Alg13-m-FLAG Plasmid

PVT14915 2 ug
EUR 325.00

Alg13 sgRNA CRISPR Lentivector set (Mouse)

K4798801 3 x 1.0 ug
EUR 339.00

Alg13 sgRNA CRISPR Lentivector set (Rat)

K6088001 3 x 1.0 ug
EUR 339.00

ALG13 sgRNA CRISPR Lentivector set (Human)

K0074301 3 x 1.0 ug
EUR 339.00

ALG13-AS1 ORF Vector (Human) (pORF)

ORF015477 1.0 ug DNA Ask for price

Alg13 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4798802 1.0 ug DNA
EUR 154.00

Alg13 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4798803 1.0 ug DNA
EUR 154.00

Alg13 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4798804 1.0 ug DNA
EUR 154.00