BIRC2

BIRC2 siRNA
20-abx909115	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BIRC2 Antibody
ABD6167	Lifescience Market	100 ug	EUR 438

BIRC2 antibody
10R-10665	Fitzgerald	100 ug	EUR 381
Description: Mouse monoclonal BIRC2 antibody

BIRC2 Antibody
32110-100ul	SAB	100ul	EUR 252

BIRC2 antibody
70R-15999	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal BIRC2 antibody

BIRC2 Antibody
DF6167	Affbiotech	200ul	EUR 304
Description: BIRC2 Antibody detects endogenous levels of total BIRC2.

BIRC2 Antibody
1-CSB-PA002703GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

BIRC2 Antibody
1-CSB-PA830383	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BIRC2 Antibody
1-CSB-PA618777EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

BIRC2 Antibody
1-CSB-PA618777ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

BIRC2 Antibody
1-CSB-PA191509	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

BIRC2 Conjugated Antibody
C32110	SAB	100ul	EUR 397

BIRC2 cloning plasmid
CSB-CL618777HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1857 Sequence: atgcacaaaactgcctcccaaagacttttcccaggtccctcgtatcaaaacattaagagtataatggaagatagcacgatcttgtcagattggacaaacagcaacaaacaaaaaatgaagtatgacttttcctgtgaactctacagaatgtctacatattcaactttccccgccg Show more
Description: A cloning plasmid for the BIRC2 gene.

BIRC2 Polyclonal Antibody
ES11955-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against BIRC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

BIRC2 Polyclonal Antibody
ES11955-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against BIRC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

BIRC2 Polyclonal Antibody
ABP57901-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Polyclonal Antibody
ABP57901-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Polyclonal Antibody
ABP57901-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Rabbit pAb
A0866-100ul	Abclonal	100 ul	EUR 308

BIRC2 Rabbit pAb
A0866-200ul	Abclonal	200 ul	EUR 459

BIRC2 Rabbit pAb
A0866-20ul	Abclonal	20 ul	EUR 183

BIRC2 Rabbit pAb
A0866-50ul	Abclonal	50 ul	EUR 223

BIRC2 Rabbit pAb
A0985-100ul	Abclonal	100 ul	EUR 308

BIRC2 Rabbit pAb
A0985-200ul	Abclonal	200 ul	EUR 459

BIRC2 Rabbit pAb
A0985-20ul	Abclonal	20 ul	EUR 183

BIRC2 Rabbit pAb
A0985-50ul	Abclonal	50 ul	EUR 223

BIRC2 Rabbit mAb
A19688-100ul	Abclonal	100 ul	EUR 410

BIRC2 Rabbit mAb
A19688-200ul	Abclonal	200 ul	EUR 571

BIRC2 Rabbit mAb
A19688-20ul	Abclonal	20 ul	EUR 221

BIRC2 Rabbit mAb
A19688-50ul	Abclonal	50 ul	EUR 287

BIRC2 Blocking Peptide
DF6167-BP	Affbiotech	1mg	EUR 195

pCMV-SPORT6-BIRC2
PVT13208	Lifescience Market	2 ug	EUR 391

pBluescriptR-BIRC2 Plasmid
PVT17205	Lifescience Market	2 ug	EUR 325

Anti-BIRC2 antibody
STJ22800	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-BIRC2 antibody
STJ114903	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-BIRC2 antibody
STJ193113	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to BIRC2

Human BIRC2 ELISA Kit
ELA-E10854h	Lifescience Market	96 Tests	EUR 824

Mouse Birc2 ELISA KIT
ELI-25177m	Lifescience Market	96 Tests	EUR 865

BIRC2 ELISA KIT\|Human
EF008515	Lifescience Market	96 Tests	EUR 689

Human BIRC2 ELISA KIT
ELI-33316h	Lifescience Market	96 Tests	EUR 824

Human BIRC2 shRNA Plasmid
20-abx950230	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-cIAP1/BIRC2 Antibody
A01700-1	BosterBio	100ug/vial	EUR 334

BIRC2 recombinant monoclonal antibody
A5797	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human BIRC2 for WB,ELISA

Mouse BIRC2 shRNA Plasmid
20-abx969182	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

BIRC2 Antibody, HRP conjugated
1-CSB-PA618777EB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIRC2 Antibody, FITC conjugated
1-CSB-PA618777EC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIRC2 Antibody, Biotin conjugated
1-CSB-PA618777ED01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-BIRC2 Monoclonal Antibody
M01700	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal BIRC2 Antibody. Validated in IF, WB and tested in Human.

BIRC2 Recombinant Protein (Human)
RP003058	ABM	100 ug	Ask for price

BIRC2 Recombinant Protein (Rat)
RP192203	ABM	100 ug	Ask for price

BIRC2 Recombinant Protein (Mouse)
RP119591	ABM	100 ug	Ask for price

BIRC2 ORF Vector (Human) (pORF)
ORF001020	ABM	1.0 ug DNA	EUR 95

Birc2 ORF Vector (Mouse) (pORF)
ORF039865	ABM	1.0 ug DNA	EUR 506

Birc2 ORF Vector (Rat) (pORF)
ORF064069	ABM	1.0 ug DNA	EUR 506

BIRC2 ELISA Kit (Human) (OKEH02117)
OKEH02117	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

BIRC2 ELISA Kit (Mouse) (OKEH05703)
OKEH05703	Aviva Systems Biology	96 Wells	EUR 870
Description: Description of target: Multi-functional protein which regulates not only caspases and apoptosis, but also modulates inflammatory signaling and immunity, mitogenic kinase signaling, and cell proliferation, as well as cell invasion and metastasis. Acts as an E3 ubiquitin-protein ligase regulating NF-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for its E3 ubiquitin-protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, TRAF2, DIABLO/SMAC, MAP3K14/NIK, MAP3K5/ASK1, IKBKG/NEMO, IKBKE and MXD1/MAD1. Can also function as an E3 ubiquitin-protein ligase of the NEDD8 conjugation pathway, targeting effector caspases for neddylation and inactivation. Acts as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). Protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase-independent manner. Suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8. Can stimulate the transcriptional activity of E2F1. Plays a role in the modulation of the cell cycle.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

BIRC2 sgRNA CRISPR Lentivector set (Human)
K0184201	ABM	3 x 1.0 ug	EUR 339

Birc2 sgRNA CRISPR Lentivector set (Mouse)
K4705101	ABM	3 x 1.0 ug	EUR 339

Birc2 sgRNA CRISPR Lentivector set (Rat)
K6825101	ABM	3 x 1.0 ug	EUR 339

BIRC2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0184202	ABM	1.0 ug DNA	EUR 154

BIRC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0184203	ABM	1.0 ug DNA	EUR 154

BIRC2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0184204	ABM	1.0 ug DNA	EUR 154

Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4705102	ABM	1.0 ug DNA	EUR 154

Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4705103	ABM	1.0 ug DNA	EUR 154

Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4705104	ABM	1.0 ug DNA	EUR 154

Birc2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6825102	ABM	1.0 ug DNA	EUR 154

Birc2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6825103	ABM	1.0 ug DNA	EUR 154

Birc2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6825104	ABM	1.0 ug DNA	EUR 154

BIRC2 Protein Vector (Human) (pPB-C-His)
PV004077	ABM	500 ng	EUR 329

BIRC2 Protein Vector (Human) (pPB-N-His)
PV004078	ABM	500 ng	EUR 329

BIRC2 Protein Vector (Human) (pPM-C-HA)
PV004079	ABM	500 ng	EUR 329

BIRC2 Protein Vector (Human) (pPM-C-His)
PV004080	ABM	500 ng	EUR 329

BIRC2 Protein Vector (Human) (pPB-His-MBP)
PV326950	ABM	500 ng	EUR 329

BIRC2 Protein Vector (Human) (pPB-His-GST)
PV326951	ABM	500 ng	EUR 329

BIRC2 Protein Vector (Rat) (pPB-C-His)
PV256274	ABM	500 ng	EUR 603

BIRC2 Protein Vector (Rat) (pPB-N-His)
PV256275	ABM	500 ng	EUR 603

BIRC2 Protein Vector (Rat) (pPM-C-HA)
PV256276	ABM	500 ng	EUR 603

BIRC2 Protein Vector (Rat) (pPM-C-His)
PV256277	ABM	500 ng	EUR 603

BIRC2 Protein Vector (Mouse) (pPB-C-His)
PV159458	ABM	500 ng	EUR 603

BIRC2 Protein Vector (Mouse) (pPB-N-His)
PV159459	ABM	500 ng	EUR 603

BIRC2 Protein Vector (Mouse) (pPM-C-HA)
PV159460	ABM	500 ng	EUR 603

BIRC2 Protein Vector (Mouse) (pPM-C-His)
PV159461	ABM	500 ng	EUR 603

Birc2 3'UTR Luciferase Stable Cell Line
TU201336	ABM	1.0 ml	Ask for price

Birc2 3'UTR GFP Stable Cell Line
TU152755	ABM	1.0 ml	Ask for price

BIRC2 3'UTR Luciferase Stable Cell Line
TU001784	ABM	1.0 ml	EUR 1394

Birc2 3'UTR Luciferase Stable Cell Line
TU102755	ABM	1.0 ml	Ask for price

BIRC2 3'UTR GFP Stable Cell Line
TU051784	ABM	1.0 ml	EUR 1394

Birc2 3'UTR GFP Stable Cell Line
TU251336	ABM	1.0 ml	Ask for price

Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody
20-abx111179	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody
20-abx128632	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.