BIRC2

BIRC2 siRNA

20-abx909115
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BIRC2 Antibody

ABD6167 100 ug
EUR 438

BIRC2 antibody

10R-10665 100 ug
EUR 381
Description: Mouse monoclonal BIRC2 antibody

BIRC2 Antibody

32110-100ul 100ul
EUR 252

BIRC2 antibody

70R-15999 50 ul
EUR 435
Description: Rabbit polyclonal BIRC2 antibody

BIRC2 Antibody

DF6167 200ul
EUR 304
Description: BIRC2 Antibody detects endogenous levels of total BIRC2.

BIRC2 Antibody

1-CSB-PA002703GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

BIRC2 Antibody

1-CSB-PA830383
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BIRC2 Antibody

1-CSB-PA618777EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

BIRC2 Antibody

1-CSB-PA618777ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

BIRC2 Antibody

1-CSB-PA191509
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

BIRC2 Conjugated Antibody

C32110 100ul
EUR 397

BIRC2 cloning plasmid

CSB-CL618777HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1857
  • Sequence: atgcacaaaactgcctcccaaagacttttcccaggtccctcgtatcaaaacattaagagtataatggaagatagcacgatcttgtcagattggacaaacagcaacaaacaaaaaatgaagtatgacttttcctgtgaactctacagaatgtctacatattcaactttccccgccg
  • Show more
Description: A cloning plasmid for the BIRC2 gene.

BIRC2 Polyclonal Antibody

ES11955-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BIRC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

BIRC2 Polyclonal Antibody

ES11955-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BIRC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

BIRC2 Polyclonal Antibody

ABP57901-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Polyclonal Antibody

ABP57901-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Polyclonal Antibody

ABP57901-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Rabbit pAb

A0866-100ul 100 ul
EUR 308

BIRC2 Rabbit pAb

A0866-200ul 200 ul
EUR 459

BIRC2 Rabbit pAb

A0866-20ul 20 ul
EUR 183

BIRC2 Rabbit pAb

A0866-50ul 50 ul
EUR 223

BIRC2 Rabbit pAb

A0985-100ul 100 ul
EUR 308

BIRC2 Rabbit pAb

A0985-200ul 200 ul
EUR 459

BIRC2 Rabbit pAb

A0985-20ul 20 ul
EUR 183

BIRC2 Rabbit pAb

A0985-50ul 50 ul
EUR 223

BIRC2 Rabbit mAb

A19688-100ul 100 ul
EUR 410

BIRC2 Rabbit mAb

A19688-200ul 200 ul
EUR 571

BIRC2 Rabbit mAb

A19688-20ul 20 ul
EUR 221

BIRC2 Rabbit mAb

A19688-50ul 50 ul
EUR 287

BIRC2 Blocking Peptide

DF6167-BP 1mg
EUR 195

pCMV-SPORT6-BIRC2

PVT13208 2 ug
EUR 391

pBluescriptR-BIRC2 Plasmid

PVT17205 2 ug
EUR 325

Anti-BIRC2 antibody

STJ22800 100 µl
EUR 277
Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-BIRC2 antibody

STJ114903 100 µl
EUR 277
Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-BIRC2 antibody

STJ193113 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BIRC2

Human BIRC2 ELISA Kit

ELA-E10854h 96 Tests
EUR 824

Mouse Birc2 ELISA KIT

ELI-25177m 96 Tests
EUR 865

BIRC2 ELISA KIT|Human

EF008515 96 Tests
EUR 689

Human BIRC2 ELISA KIT

ELI-33316h 96 Tests
EUR 824

Human BIRC2 shRNA Plasmid

20-abx950230
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-cIAP1/BIRC2 Antibody

A01700-1 100ug/vial
EUR 334

BIRC2 recombinant monoclonal antibody

A5797 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human BIRC2 for WB,ELISA

Mouse BIRC2 shRNA Plasmid

20-abx969182
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BIRC2 Antibody, HRP conjugated

1-CSB-PA618777EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIRC2 Antibody, FITC conjugated

1-CSB-PA618777EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIRC2 Antibody, Biotin conjugated

1-CSB-PA618777ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-BIRC2 Monoclonal Antibody

M01700 100ug
EUR 397
Description: Rabbit Monoclonal BIRC2 Antibody. Validated in IF, WB and tested in Human.

BIRC2 Recombinant Protein (Human)

RP003058 100 ug Ask for price

BIRC2 Recombinant Protein (Rat)

RP192203 100 ug Ask for price

BIRC2 Recombinant Protein (Mouse)

RP119591 100 ug Ask for price

BIRC2 ORF Vector (Human) (pORF)

ORF001020 1.0 ug DNA
EUR 95

Birc2 ORF Vector (Mouse) (pORF)

ORF039865 1.0 ug DNA
EUR 506

Birc2 ORF Vector (Rat) (pORF)

ORF064069 1.0 ug DNA
EUR 506

BIRC2 ELISA Kit (Human) (OKEH02117)

OKEH02117 96 Wells
EUR 740
Description: Description of target: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

BIRC2 ELISA Kit (Mouse) (OKEH05703)

OKEH05703 96 Wells
EUR 870
Description: Description of target: Multi-functional protein which regulates not only caspases and apoptosis, but also modulates inflammatory signaling and immunity, mitogenic kinase signaling, and cell proliferation, as well as cell invasion and metastasis. Acts as an E3 ubiquitin-protein ligase regulating NF-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for its E3 ubiquitin-protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, TRAF2, DIABLO/SMAC, MAP3K14/NIK, MAP3K5/ASK1, IKBKG/NEMO, IKBKE and MXD1/MAD1. Can also function as an E3 ubiquitin-protein ligase of the NEDD8 conjugation pathway, targeting effector caspases for neddylation and inactivation. Acts as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). Protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase-independent manner. Suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8. Can stimulate the transcriptional activity of E2F1. Plays a role in the modulation of the cell cycle.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

BIRC2 sgRNA CRISPR Lentivector set (Human)

K0184201 3 x 1.0 ug
EUR 339

Birc2 sgRNA CRISPR Lentivector set (Mouse)

K4705101 3 x 1.0 ug
EUR 339

Birc2 sgRNA CRISPR Lentivector set (Rat)

K6825101 3 x 1.0 ug
EUR 339

BIRC2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0184202 1.0 ug DNA
EUR 154

BIRC2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0184203 1.0 ug DNA
EUR 154

BIRC2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0184204 1.0 ug DNA
EUR 154

Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4705102 1.0 ug DNA
EUR 154

Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4705103 1.0 ug DNA
EUR 154

Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4705104 1.0 ug DNA
EUR 154

Birc2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6825102 1.0 ug DNA
EUR 154

Birc2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6825103 1.0 ug DNA
EUR 154

Birc2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6825104 1.0 ug DNA
EUR 154

BIRC2 Protein Vector (Human) (pPB-C-His)

PV004077 500 ng
EUR 329

BIRC2 Protein Vector (Human) (pPB-N-His)

PV004078 500 ng
EUR 329

BIRC2 Protein Vector (Human) (pPM-C-HA)

PV004079 500 ng
EUR 329

BIRC2 Protein Vector (Human) (pPM-C-His)

PV004080 500 ng
EUR 329

BIRC2 Protein Vector (Human) (pPB-His-MBP)

PV326950 500 ng
EUR 329

BIRC2 Protein Vector (Human) (pPB-His-GST)

PV326951 500 ng
EUR 329

BIRC2 Protein Vector (Rat) (pPB-C-His)

PV256274 500 ng
EUR 603

BIRC2 Protein Vector (Rat) (pPB-N-His)

PV256275 500 ng
EUR 603

BIRC2 Protein Vector (Rat) (pPM-C-HA)

PV256276 500 ng
EUR 603

BIRC2 Protein Vector (Rat) (pPM-C-His)

PV256277 500 ng
EUR 603

BIRC2 Protein Vector (Mouse) (pPB-C-His)

PV159458 500 ng
EUR 603

BIRC2 Protein Vector (Mouse) (pPB-N-His)

PV159459 500 ng
EUR 603

BIRC2 Protein Vector (Mouse) (pPM-C-HA)

PV159460 500 ng
EUR 603

BIRC2 Protein Vector (Mouse) (pPM-C-His)

PV159461 500 ng
EUR 603

Birc2 3'UTR Luciferase Stable Cell Line

TU201336 1.0 ml Ask for price

Birc2 3'UTR GFP Stable Cell Line

TU152755 1.0 ml Ask for price

BIRC2 3'UTR Luciferase Stable Cell Line

TU001784 1.0 ml
EUR 1394

Birc2 3'UTR Luciferase Stable Cell Line

TU102755 1.0 ml Ask for price

BIRC2 3'UTR GFP Stable Cell Line

TU051784 1.0 ml
EUR 1394

Birc2 3'UTR GFP Stable Cell Line

TU251336 1.0 ml Ask for price

Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody

20-abx111179
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody

20-abx128632
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.