BIRC2

BIRC2 siRNA

20-abx909115
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BIRC2 antibody

70R-15999 50 ul
EUR 435.00
Description: Rabbit polyclonal BIRC2 antibody

BIRC2 Antibody

ABD6167 100 ug
EUR 438.00

BIRC2 Antibody

1-CSB-PA002703GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

BIRC2 Antibody

1-CSB-PA618777EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

BIRC2 Antibody

1-CSB-PA618777ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

BIRC2 Antibody

1-CSB-PA191509
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

BIRC2 Antibody

1-CSB-PA830383
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BIRC2 Antibody

DF6167 200ul
EUR 304.00
Description: BIRC2 Antibody detects endogenous levels of total BIRC2.

BIRC2 antibody

10R-10665 100 ug
EUR 381.00
Description: Mouse monoclonal BIRC2 antibody

BIRC2 Antibody

32110-100ul 100ul
EUR 252.00

BIRC2 Rabbit mAb

A19688-100ul 100 ul
EUR 410.00

BIRC2 Rabbit mAb

A19688-200ul 200 ul
EUR 571.00

BIRC2 Rabbit mAb

A19688-20ul 20 ul
EUR 221.00

BIRC2 Rabbit mAb

A19688-50ul 50 ul
EUR 287.00

BIRC2 Rabbit pAb

A0866-100ul 100 ul
EUR 308.00

BIRC2 Rabbit pAb

A0866-200ul 200 ul
EUR 459.00

BIRC2 Rabbit pAb

A0866-20ul 20 ul
EUR 183.00

BIRC2 Rabbit pAb

A0866-50ul 50 ul
EUR 223.00

BIRC2 Rabbit pAb

A0985-100ul 100 ul
EUR 308.00

BIRC2 Rabbit pAb

A0985-200ul 200 ul
EUR 459.00

BIRC2 Rabbit pAb

A0985-20ul 20 ul
EUR 183.00

BIRC2 Rabbit pAb

A0985-50ul 50 ul
EUR 223.00

BIRC2 Blocking Peptide

DF6167-BP 1mg
EUR 195.00

BIRC2 cloning plasmid

CSB-CL618777HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1857
  • Sequence: atgcacaaaactgcctcccaaagacttttcccaggtccctcgtatcaaaacattaagagtataatggaagatagcacgatcttgtcagattggacaaacagcaacaaacaaaaaatgaagtatgacttttcctgtgaactctacagaatgtctacatattcaactttccccgccg
  • Show more
Description: A cloning plasmid for the BIRC2 gene.

BIRC2 Polyclonal Antibody

ABP57901-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Polyclonal Antibody

ABP57901-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Polyclonal Antibody

ABP57901-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Polyclonal Antibody

E-AB-10627-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding t
  • Show more
Description: Rabbit antibody against Human,Mouse BIRC2 for WB,ELISA applications.

BIRC2 Polyclonal Antibody

E-AB-10627-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding t
  • Show more
Description: Rabbit antibody against Human,Mouse BIRC2 for WB,ELISA applications.

BIRC2 Polyclonal Antibody

E-AB-10627-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding t
  • Show more
Description: Rabbit antibody against Human,Mouse BIRC2 for WB,ELISA applications.

BIRC2 Conjugated Antibody

C32110 100ul
EUR 397.00

BIRC2 Polyclonal Antibody

ES11955-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against BIRC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

BIRC2 Polyclonal Antibody

ES11955-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against BIRC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-BIRC2 antibody

STJ114903 100 µl
EUR 277.00
Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-BIRC2 antibody

STJ22800 100 µl
EUR 277.00
Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-BIRC2 antibody

STJ193113 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to BIRC2

pCMV-SPORT6-BIRC2

PVT13208 2 ug
EUR 391.00

pBluescriptR-BIRC2 Plasmid

PVT17205 2 ug
EUR 325.00

Mouse BIRC2 shRNA Plasmid

20-abx969182
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BIRC2 shRNA Plasmid

20-abx950230
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-cIAP1/BIRC2 Antibody

A01700-1 100ug/vial
EUR 334.00

BIRC2 recombinant monoclonal antibody

A5797 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human BIRC2 for WB,ELISA

BIRC2 Antibody, HRP conjugated

1-CSB-PA618777EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIRC2 Antibody, FITC conjugated

1-CSB-PA618777EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIRC2 Antibody, Biotin conjugated

1-CSB-PA618777ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human BIRC2 ELISA KIT

ELI-33316h 96 Tests
EUR 824.00

Mouse Birc2 ELISA KIT

ELI-25177m 96 Tests
EUR 865.00

BIRC2 ELISA KIT|Human

EF008515 96 Tests
EUR 689.00

Human BIRC2 ELISA Kit

ELA-E10854h 96 Tests
EUR 824.00

Anti-BIRC2 Monoclonal Antibody

M01700 100ug
EUR 397.00
Description: Rabbit Monoclonal BIRC2 Antibody. Validated in IF, WB and tested in Human.

BIRC2 Recombinant Protein (Rat)

RP192203 100 ug Ask for price

BIRC2 Recombinant Protein (Human)

RP003058 100 ug Ask for price

BIRC2 Recombinant Protein (Mouse)

RP119591 100 ug Ask for price

Birc2 ORF Vector (Mouse) (pORF)

ORF039865 1.0 ug DNA
EUR 506.00

Birc2 ORF Vector (Rat) (pORF)

ORF064069 1.0 ug DNA
EUR 506.00

BIRC2 ORF Vector (Human) (pORF)

ORF001020 1.0 ug DNA
EUR 95.00

BIRC2 sgRNA CRISPR Lentivector set (Human)

K0184201 3 x 1.0 ug
EUR 339.00

Birc2 sgRNA CRISPR Lentivector set (Rat)

K6825101 3 x 1.0 ug
EUR 339.00

Birc2 sgRNA CRISPR Lentivector set (Mouse)

K4705101 3 x 1.0 ug
EUR 339.00

BIRC2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0184202 1.0 ug DNA
EUR 154.00

BIRC2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0184203 1.0 ug DNA
EUR 154.00

BIRC2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0184204 1.0 ug DNA
EUR 154.00

Birc2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6825102 1.0 ug DNA
EUR 154.00

Birc2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6825103 1.0 ug DNA
EUR 154.00

Birc2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6825104 1.0 ug DNA
EUR 154.00

Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4705102 1.0 ug DNA
EUR 154.00

Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4705103 1.0 ug DNA
EUR 154.00

Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4705104 1.0 ug DNA
EUR 154.00

BIRC2 3'UTR Luciferase Stable Cell Line

TU001784 1.0 ml
EUR 1394.00

BIRC2 Protein Vector (Mouse) (pPB-C-His)

PV159458 500 ng
EUR 603.00

BIRC2 Protein Vector (Mouse) (pPB-N-His)

PV159459 500 ng
EUR 603.00

BIRC2 Protein Vector (Mouse) (pPM-C-HA)

PV159460 500 ng
EUR 603.00

BIRC2 Protein Vector (Mouse) (pPM-C-His)

PV159461 500 ng
EUR 603.00

BIRC2 Protein Vector (Human) (pPB-C-His)

PV004077 500 ng
EUR 329.00

BIRC2 Protein Vector (Human) (pPB-N-His)

PV004078 500 ng
EUR 329.00

BIRC2 Protein Vector (Human) (pPM-C-HA)

PV004079 500 ng
EUR 329.00

BIRC2 Protein Vector (Human) (pPM-C-His)

PV004080 500 ng
EUR 329.00

BIRC2 Protein Vector (Rat) (pPB-C-His)

PV256274 500 ng
EUR 603.00

BIRC2 Protein Vector (Rat) (pPB-N-His)

PV256275 500 ng
EUR 603.00

BIRC2 Protein Vector (Rat) (pPM-C-HA)

PV256276 500 ng
EUR 603.00

BIRC2 Protein Vector (Rat) (pPM-C-His)

PV256277 500 ng
EUR 603.00

BIRC2 Protein Vector (Human) (pPB-His-MBP)

PV326950 500 ng
EUR 329.00

BIRC2 Protein Vector (Human) (pPB-His-GST)

PV326951 500 ng
EUR 329.00

Birc2 3'UTR GFP Stable Cell Line

TU152755 1.0 ml Ask for price

Birc2 3'UTR Luciferase Stable Cell Line

TU201336 1.0 ml Ask for price

BIRC2 3'UTR GFP Stable Cell Line

TU051784 1.0 ml
EUR 1394.00

Birc2 3'UTR Luciferase Stable Cell Line

TU102755 1.0 ml Ask for price

Birc2 3'UTR GFP Stable Cell Line

TU251336 1.0 ml Ask for price

Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody

20-abx211979
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.