CALCA / CALCA Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calca/ Rat Calca ELISA Kit

ELI-25243r 96 Tests
EUR 886.00

CALCA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CALCA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA

CALCA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CALCA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CALCA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CALCA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

CALCA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CALCA antibody

10R-8356 100 ul
EUR 392.00
Description: Mouse monoclonal CALCA antibody

CALCA Antibody

32898-100ul 100ul
EUR 252.00

CALCA Antibody

DF7386 200ul
EUR 304.00
Description: CALCA Antibody detects endogenous levels of total CALCA.

CALCA Antibody

DF7785 200ul
EUR 304.00
Description: CALCA Antibody detects endogenous levels of total CALCA.

CALCA Antibody

ABD7386 100 ug
EUR 438.00

CALCA Antibody

ABD7785 100 ug
EUR 438.00

CALCA Antibody

ABD7786 100 ug
EUR 438.00

CALCA Antibody

ABD7985 100 ug
EUR 438.00

Calcitonin (CALCA) Antibody

abx146688-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx148151-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Calcitonin (CALCA) Antibody

  • EUR 342.00
  • EUR 899.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcitonin (CALCA) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcitonin (CALCA) Antibody

  • EUR 328.00
  • EUR 843.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

CALCA Conjugated Antibody

C32898 100ul
EUR 397.00

CALCA cloning plasmid

CSB-CL004434HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atgggcttccaaaagttctcccccttcctggctctcagcatcttggtcctgttgcaggcaggcagcctccatgcagcaccattcaggtctgccctggagagcagcccagcagacccggccacgctcagtgaggacgaagcgcgcctcctgctggctgcactggtgcaggactatgt
  • Show more
Description: A cloning plasmid for the CALCA gene.

Dog Calcitonin (CALCA)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Dog Calcitonin(CALCA),partial expressed in E.coli

CALCA/CALCB antibody

31944-100ul 100ul
EUR 252.00

CALCA/CALCB antibody

31944-50ul 50ul
EUR 187.00

CALCA Polyclonal Antibody

A52257 100 µg
EUR 570.55
Description: fast delivery possible

CALCA Polyclonal Antibody

ABP57963-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120

CALCA Polyclonal Antibody

ABP57963-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120

CALCA Polyclonal Antibody

ABP57963-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120

Calcitonin (CALCA) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx022516-20ul 20 ul
EUR 328.00
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx025389-100ul 100 ul
EUR 523.00
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx025390-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx025390-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx026097-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx026097-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx028427-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx028427-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

CALCA Polyclonal Antibody

E-AB-12338-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tiss
  • Show more
Description: Rabbit antibody against Human CALCA for IHC,ELISA applications.

CALCA Polyclonal Antibody

E-AB-12338-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tiss
  • Show more
Description: Rabbit antibody against Human CALCA for IHC,ELISA applications.

CALCA Polyclonal Antibody

E-AB-12338-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tiss
  • Show more
Description: Rabbit antibody against Human CALCA for IHC,ELISA applications.

CALCA Blocking Peptide

DF7386-BP 1mg
EUR 195.00

CALCA Blocking Peptide

DF7785-BP 1mg
EUR 195.00

CALCA Rabbit pAb

A13957-100ul 100 ul
EUR 308.00

CALCA Rabbit pAb

A13957-200ul 200 ul
EUR 459.00

CALCA Rabbit pAb

A13957-20ul 20 ul
EUR 183.00

CALCA Rabbit pAb

A13957-50ul 50 ul
EUR 223.00

CALCA Rabbit pAb

A11804-100ul 100 ul
EUR 308.00

CALCA Rabbit pAb

A11804-200ul 200 ul
EUR 459.00

CALCA Rabbit pAb

A11804-20ul 20 ul Ask for price

CALCA Rabbit pAb

A11804-50ul 50 ul Ask for price

CALCA Polyclonal Antibody

E-AB-36258-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by
  • Show more
Description: Rabbit antibody against Human CALCA for WB,ELISA applications.

CALCA Polyclonal Antibody

E-AB-36258-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by
  • Show more
Description: Rabbit antibody against Human CALCA for WB,ELISA applications.

CALCA Polyclonal Antibody

E-AB-36258-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by
  • Show more
Description: Rabbit antibody against Human CALCA for WB,ELISA applications.

CALCA Polyclonal Antibody

ES11390-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against CALCA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CALCA Polyclonal Antibody

ES11390-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against CALCA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-CALCA antibody

STJ192548 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to CALCA

Anti-CALCA Antibody

STJ500585 100 µg
EUR 476.00

Anti-CALCA Antibody

STJ500586 100 µg
EUR 476.00

Anti-CALCA antibody

STJ113383 100 µl
EUR 277.00
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CALCA antibody

STJ115892 100 µl
EUR 277.00
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CALCA antibody

STJ27531 100 µl
EUR 277.00
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.

Polyclonal CALCA Antibody (Center)

APR11539G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCA (Center). This antibody is tested and proven to work in the following applications:

Rat CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CALCA Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is HRP conjugated. Tested in the following application: ELISA

CALCA Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is FITC conjugated. Tested in the following application: ELISA

CALCA Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is Biotin conjugated. Tested in the following application: ELISA

CALCA Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALCA Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALCA Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Katacalcin (CALCA) Protein

abx670053-01mg 0.1 mg
EUR 286.00
  • Shipped within 1 week.

Mouse CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-Calcitonin/Calca Antibody

A02352 100ug/vial
EUR 334.00


ELI-50378d 96 Tests
EUR 928.00


EF004510 96 Tests
EUR 689.00


ELA-E1213h 96 Tests
EUR 824.00

Anti-Calcitonin/CALCA Antibody

PB9936 100ug/vial
EUR 334.00

Anti-Calcitonin/CALCA Antibody

PB9937 100ug/vial
EUR 334.00

CALCA Recombinant Protein (Human)

RP005446 100 ug Ask for price

CALCA Recombinant Protein (Mouse)

RP120794 100 ug Ask for price

CALCA Recombinant Protein (Mouse)

RP120797 100 ug Ask for price