CDCA8

CDCA8 Antibody

1-CSB-PA005031GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDCA8. Recognizes CDCA8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CDCA8 Antibody

1-CSB-PA700653ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDCA8. Recognizes CDCA8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CDCA8 Antibody

1-CSB-PA232587
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDCA8. Recognizes CDCA8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

CDCA8 Antibody

24735-100ul 100ul
EUR 390.00

CDCA8 antibody

38138-100ul 100ul
EUR 252.00

CDCA8 Antibody

36163-100ul 100ul
EUR 252.00

CDCA8 siRNA

20-abx900949
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDCA8 siRNA

20-abx911186
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDCA8 siRNA

20-abx911187
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDCA8 Antibody

1-CSB-PA936102
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDCA8. Recognizes CDCA8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

CDCA8 Antibody

DF6115 200ul
EUR 304.00
Description: CDCA8 Antibody detects endogenous levels of total CDCA8.

CDCA8 Antibody

ABD6115 100 ug
EUR 438.00

CDCA8 antibody

70R-16314 50 ul
EUR 435.00
Description: Rabbit polyclonal CDCA8 antibody

pOTB7-CDCA8

PVT18426 2 ug
EUR 231.00

pENTR223-CDCA8

PVTH0012 2 ug
EUR 345.00

Borealin (CDCA8) Antibody

20-abx111536
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

CDCA8 Conjugated Antibody

C38138 100ul
EUR 397.00

CDCA8 Conjugated Antibody

C36163 100ul
EUR 397.00

Polyclonal CDCA8 Antibody

APR06493G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDCA8 . This antibody is tested and proven to work in the following applications:

CDCA8 cloning plasmid

CSB-CL700653HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atggctcctaggaagggcagtagtcgggtggccaataccaactccttacggaggcggaagctcgcctcctttctgaaagacttcgaccgtgaagtggaaatacgaatcaagcaaattgagtcagacaggcagaacctcctcaaggaggtggataacctctacaacatcgagatcct
  • Show more
Description: A cloning plasmid for the CDCA8 gene.

CDCA8 cloning plasmid

CSB-CL700653HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atggctcctaggaagggcagtagtcgggtggccaagaccaactccttacggaggcggaagctcgcctcctttctgaaagacttcgaccgtgaagtggaaatacgaatcaagcaaattgagtcagacaggcagaacctcctcaaggaggtggataacctctacaacatcgagatcct
  • Show more
Description: A cloning plasmid for the CDCA8 gene.

Borealin (CDCA8) Antibody

abx025228-100ul 100 ul
EUR 523.00
  • Shipped within 5-10 working days.

Borealin (CDCA8) Antibody

abx025229-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Borealin (CDCA8) Antibody

abx025229-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Borealin (CDCA8) Antibody

abx028083-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Borealin (CDCA8) Antibody

abx028083-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Borealin (CDCA8) Antibody

20-abx000810
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Borealin (CDCA8) Antibody

20-abx320266
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Borealin (CDCA8) Antibody

20-abx210384
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Borealin (CDCA8) Antibody

20-abx210385
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Borealin (CDCA8) Antibody

abx231544-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

CDCA8 Polyclonal Antibody

E-AB-10868-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulato
  • Show more
Description: Rabbit antibody against Human CDCA8 for WB,IHC,ELISA applications.

CDCA8 Polyclonal Antibody

E-AB-10868-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulato
  • Show more
Description: Rabbit antibody against Human CDCA8 for WB,IHC,ELISA applications.

CDCA8 Polyclonal Antibody

E-AB-10868-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulato
  • Show more
Description: Rabbit antibody against Human CDCA8 for WB,IHC,ELISA applications.

CDCA8 Blocking Peptide

DF6115-BP 1mg
EUR 195.00

CDCA8 Rabbit pAb

A12594-100ul 100 ul
EUR 308.00

CDCA8 Rabbit pAb

A12594-200ul 200 ul
EUR 459.00

CDCA8 Rabbit pAb

A12594-20ul 20 ul
EUR 183.00

CDCA8 Rabbit pAb

A12594-50ul 50 ul
EUR 223.00

CDCA8 Rabbit pAb

A15463-100ul 100 ul
EUR 308.00

CDCA8 Rabbit pAb

A15463-200ul 200 ul
EUR 459.00

CDCA8 Rabbit pAb

A15463-20ul 20 ul
EUR 183.00

CDCA8 Rabbit pAb

A15463-50ul 50 ul
EUR 223.00

CDCA8 Rabbit pAb

A0675-100ul 100 ul
EUR 308.00

CDCA8 Rabbit pAb

A0675-200ul 200 ul
EUR 459.00

CDCA8 Rabbit pAb

A0675-20ul 20 ul
EUR 183.00

CDCA8 Rabbit pAb

A0675-50ul 50 ul
EUR 223.00

anti- CDCA8 antibody

FNab01544 100µg
EUR 505.25
  • Immunogen: cell division cycle associated 8
  • Uniprot ID: Q53HL2
  • Gene ID: 55143
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against CDCA8

Anti-CDCA8 antibody

PAab01544 100 ug
EUR 355.00

pOTB7-CDCA8-2

PVT18774 2 ug
EUR 231.00

pENTR223-CDCA8 vector

PVT11938 2 ug
EUR 308.00

Anti-CDCA8 antibody

STJ23035 100 µl
EUR 277.00
Description: This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulator of mitosis and cell division. This protein is cell-cycle regulated and is required for chromatin-induced microtubule stabilization and spindle formation. Alternate splicing results in multiple transcript variants. Pseudgenes of this gene are found on chromosomes 7, 8 and 16.

Anti-CDCA8 antibody

STJ117658 100 µl
EUR 277.00
Description: This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulator of mitosis and cell division. This protein is cell-cycle regulated and is required for chromatin-induced microtubule stabilization and spindle formation. Alternate splicing results in multiple transcript variants. Pseudgenes of this gene are found on chromosomes 7, 8 and 16.

Anti-CDCA8 antibody

STJ114468 100 µl
EUR 277.00
Description: This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulator of mitosis and cell division. This protein is cell-cycle regulated and is required for chromatin-induced microtubule stabilization and spindle formation. Alternate splicing results in multiple transcript variants. Pseudgenes of this gene are found on chromosomes 7, 8 and 16.

anti-Borealin/CDCA8

YF-PA19570 50 ug
EUR 363.00
Description: Mouse polyclonal to Borealin/CDCA8

anti-Borealin/CDCA8

YF-PA19571 50 ug
EUR 363.00
Description: Mouse polyclonal to Borealin/CDCA8

anti-Borealin/CDCA8

YF-PA19572 100 ul
EUR 403.00
Description: Rabbit polyclonal to Borealin/CDCA8

anti-Borealin/CDCA8

YF-PA19573 100 ug
EUR 403.00
Description: Rabbit polyclonal to Borealin/CDCA8

Rat CDCA8 shRNA Plasmid

20-abx990988
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal CDCA8 Antibody (Center)

APR03962G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDCA8 (Center). This antibody is tested and proven to work in the following applications:

Mouse CDCA8 shRNA Plasmid

20-abx974225
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CDCA8 shRNA Plasmid

20-abx960499
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDCA8 protein (His tag)

80R-1807 50 ug
EUR 397.00
Description: Purified recombinant Human CDCA8 protein

CDCA8 ELISA KIT|Human

EF008562 96 Tests
EUR 689.00

CDCA8 Recombinant Protein (Human)

RP006562 100 ug Ask for price

CDCA8 Recombinant Protein (Human)

RP006565 100 ug Ask for price

CDCA8 Recombinant Protein (Rat)

RP194192 100 ug Ask for price

CDCA8 Recombinant Protein (Mouse)

RP122930 100 ug Ask for price

Monoclonal CDCA8 Antibody, Clone: 181CT41.2.3

AMM02343G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human CDCA8. The antibodies are raised in Mouse and are from clone 181CT41.2.3. This antibody is applicable in WB, E

Rat Borealin (CDCA8) ELISA Kit

abx391105-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Human Borealin (CDCA8) ELISA Kit

abx386431-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse Borealin (CDCA8) ELISA Kit

abx388830-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Chicken Borealin, CDCA8 ELISA KIT

ELI-50395c 96 Tests
EUR 928.00

Mouse Borealin, Cdca8 ELISA KIT

ELI-50044m 96 Tests
EUR 865.00

Monkey Borealin(CDCA8) ELISA kit

E09B0884-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Borealin(CDCA8) ELISA kit

E09B0884-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Borealin(CDCA8) ELISA kit

E09B0884-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Borealin, CDCA8 ELISA KIT

ELI-33370h 96 Tests
EUR 824.00

Human Borealin(CDCA8) ELISA kit

E01B0884-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Borealin(CDCA8) ELISA kit

E01B0884-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Borealin(CDCA8) ELISA kit

E01B0884-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Borealin(CDCA8) ELISA kit

E07B0884-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Borealin(CDCA8) ELISA kit

E07B0884-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Borealin(CDCA8) ELISA kit

E07B0884-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Borealin(CDCA8) ELISA kit

E04B0884-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Borealin(CDCA8) ELISA kit

E04B0884-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Borealin(CDCA8) ELISA kit

E04B0884-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Borealin(CDCA8) ELISA kit

E02B0884-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Borealin(CDCA8) ELISA kit

E02B0884-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Borealin(CDCA8) ELISA kit

E02B0884-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.