CDCA8

CDCA8 siRNA
20-abx900949	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDCA8 siRNA
20-abx911186	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDCA8 siRNA
20-abx911187	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDCA8 Antibody
ABD6115	Lifescience Market	100 ug	EUR 438

CDCA8 Antibody
36163-100ul	SAB	100ul	EUR 252

CDCA8 antibody
38138-100ul	SAB	100ul	EUR 252

CDCA8 Antibody
24735-100ul	SAB	100ul	EUR 390

CDCA8 antibody
70R-16314	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CDCA8 antibody

CDCA8 Antibody
DF6115	Affbiotech	200ul	EUR 304
Description: CDCA8 Antibody detects endogenous levels of total CDCA8.

CDCA8 Antibody
1-CSB-PA936102	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDCA8. Recognizes CDCA8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

CDCA8 Antibody
1-CSB-PA005031GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDCA8. Recognizes CDCA8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CDCA8 Antibody
1-CSB-PA700653ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDCA8. Recognizes CDCA8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CDCA8 Antibody
1-CSB-PA232587	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDCA8. Recognizes CDCA8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

pOTB7-CDCA8
PVT18426	Lifescience Market	2 ug	EUR 231

pENTR223-CDCA8
PVTH0012	Lifescience Market	2 ug	EUR 345

CDCA8 Conjugated Antibody
C38138	SAB	100ul	EUR 397

Polyclonal CDCA8 Antibody
APR06493G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDCA8 . This antibody is tested and proven to work in the following applications:

CDCA8 Conjugated Antibody
C36163	SAB	100ul	EUR 397

anti- CDCA8 antibody
FNab01544	FN Test	100µg	EUR 505.25
Immunogen: cell division cycle associated 8 Uniprot ID: Q53HL2 Gene ID: 55143 Research Area: Cell Division and Proliferation
Description: Antibody raised against CDCA8

Borealin (CDCA8) Antibody
20-abx111536	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Borealin (CDCA8) Antibody
20-abx000810	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Borealin (CDCA8) Antibody
abx025228-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Borealin (CDCA8) Antibody
abx025229-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Borealin (CDCA8) Antibody
abx025229-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Borealin (CDCA8) Antibody
abx028083-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Borealin (CDCA8) Antibody
abx028083-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Borealin (CDCA8) Antibody
20-abx320266	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Borealin (CDCA8) Antibody
abx231544-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Borealin (CDCA8) Antibody
20-abx210384	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Borealin (CDCA8) Antibody
20-abx210385	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

CDCA8 Rabbit pAb
A0675-100ul	Abclonal	100 ul	EUR 308

CDCA8 Rabbit pAb
A0675-200ul	Abclonal	200 ul	EUR 459

CDCA8 Rabbit pAb
A0675-20ul	Abclonal	20 ul	EUR 183

CDCA8 Rabbit pAb
A0675-50ul	Abclonal	50 ul	EUR 223

CDCA8 Rabbit pAb
A12594-100ul	Abclonal	100 ul	EUR 308

CDCA8 Rabbit pAb
A12594-200ul	Abclonal	200 ul	EUR 459

CDCA8 Rabbit pAb
A12594-20ul	Abclonal	20 ul	EUR 183

CDCA8 Rabbit pAb
A12594-50ul	Abclonal	50 ul	EUR 223

CDCA8 Rabbit pAb
A15463-100ul	Abclonal	100 ul	EUR 308

CDCA8 Rabbit pAb
A15463-200ul	Abclonal	200 ul	EUR 459

CDCA8 Rabbit pAb
A15463-20ul	Abclonal	20 ul	EUR 183

CDCA8 Rabbit pAb
A15463-50ul	Abclonal	50 ul	EUR 223

CDCA8 Blocking Peptide
DF6115-BP	Affbiotech	1mg	EUR 195

CDCA8 cloning plasmid
CSB-CL700653HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 843 Sequence: atggctcctaggaagggcagtagtcgggtggccaataccaactccttacggaggcggaagctcgcctcctttctgaaagacttcgaccgtgaagtggaaatacgaatcaagcaaattgagtcagacaggcagaacctcctcaaggaggtggataacctctacaacatcgagatcct Show more
Description: A cloning plasmid for the CDCA8 gene.

CDCA8 cloning plasmid
CSB-CL700653HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 843 Sequence: atggctcctaggaagggcagtagtcgggtggccaagaccaactccttacggaggcggaagctcgcctcctttctgaaagacttcgaccgtgaagtggaaatacgaatcaagcaaattgagtcagacaggcagaacctcctcaaggaggtggataacctctacaacatcgagatcct Show more
Description: A cloning plasmid for the CDCA8 gene.

Anti-CDCA8 antibody
PAab01544	Lifescience Market	100 ug	EUR 355

pOTB7-CDCA8-2
PVT18774	Lifescience Market	2 ug	EUR 231

pENTR223-CDCA8 vector
PVT11938	Lifescience Market	2 ug	EUR 308

Anti-CDCA8 antibody
STJ23035	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulator of mitosis and cell division. This protein is cell-cycle regulated and is required for chromatin-induced microtubule stabilization and spindle formation. Alternate splicing results in multiple transcript variants. Pseudgenes of this gene are found on chromosomes 7, 8 and 16.

Anti-CDCA8 antibody
STJ114468	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulator of mitosis and cell division. This protein is cell-cycle regulated and is required for chromatin-induced microtubule stabilization and spindle formation. Alternate splicing results in multiple transcript variants. Pseudgenes of this gene are found on chromosomes 7, 8 and 16.

Anti-CDCA8 antibody
STJ117658	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a component of the chromosomal passenger complex. This complex is an essential regulator of mitosis and cell division. This protein is cell-cycle regulated and is required for chromatin-induced microtubule stabilization and spindle formation. Alternate splicing results in multiple transcript variants. Pseudgenes of this gene are found on chromosomes 7, 8 and 16.

anti-Borealin/CDCA8
YF-PA19570	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Borealin/CDCA8

anti-Borealin/CDCA8
YF-PA19571	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Borealin/CDCA8

anti-Borealin/CDCA8
YF-PA19572	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to Borealin/CDCA8

anti-Borealin/CDCA8
YF-PA19573	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Borealin/CDCA8

Polyclonal CDCA8 Antibody (Center)
APR03962G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDCA8 (Center). This antibody is tested and proven to work in the following applications:

Mouse CDCA8 shRNA Plasmid
20-abx974225	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CDCA8 ELISA KIT|Human
EF008562	Lifescience Market	96 Tests	EUR 689

CDCA8 protein (His tag)
80R-1807	Fitzgerald	50 ug	EUR 397
Description: Purified recombinant Human CDCA8 protein

Rat CDCA8 shRNA Plasmid
20-abx990988	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CDCA8 shRNA Plasmid
20-abx960499	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CDCA8 Recombinant Protein (Human)
RP006562	ABM	100 ug	Ask for price

CDCA8 Recombinant Protein (Human)
RP006565	ABM	100 ug	Ask for price

CDCA8 Recombinant Protein (Rat)
RP194192	ABM	100 ug	Ask for price

CDCA8 Recombinant Protein (Mouse)
RP122930	ABM	100 ug	Ask for price

CDCA8 (Human) ELISA Kit
E4813-100	Biovision	96 assay	EUR 784

Monoclonal CDCA8 Antibody, Clone: 181CT41.2.3
AMM02343G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human CDCA8. The antibodies are raised in Mouse and are from clone 181CT41.2.3. This antibody is applicable in WB, E

Goat Borealin(CDCA8) ELISA kit
E06B0884-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Borealin(CDCA8) ELISA kit
E06B0884-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Borealin(CDCA8) ELISA kit
E06B0884-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Borealin(CDCA8) ELISA kit
E02B0884-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Borealin(CDCA8) ELISA kit
E02B0884-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Borealin(CDCA8) ELISA kit
E02B0884-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Borealin(CDCA8) ELISA kit
E01B0884-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Borealin(CDCA8) ELISA kit
E01B0884-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Borealin(CDCA8) ELISA kit
E01B0884-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Borealin(CDCA8) ELISA kit
E03B0884-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Borealin(CDCA8) ELISA kit
E03B0884-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Borealin(CDCA8) ELISA kit
E03B0884-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Borealin(CDCA8) ELISA kit
E04B0884-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Borealin(CDCA8) ELISA kit
E04B0884-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Borealin(CDCA8) ELISA kit
E04B0884-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Borealin(CDCA8) ELISA kit
E07B0884-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Borealin(CDCA8) ELISA kit
E07B0884-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Borealin(CDCA8) ELISA kit
E07B0884-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Borealin(CDCA8) ELISA kit
E09B0884-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Borealin(CDCA8) ELISA kit
E09B0884-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Borealin(CDCA8) ELISA kit
E09B0884-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Borealin(CDCA8) ELISA kit
E08B0884-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Borealin(CDCA8) ELISA kit
E08B0884-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Borealin(CDCA8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.