COG4 antibody

70R-2997 50 ug
EUR 467
Description: Rabbit polyclonal COG4 antibody raised against the middle region of COG4

COG4 Antibody

46966-100ul 100ul
EUR 252

COG4 Antibody

1-CSB-PA881003ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against COG4. Recognizes COG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

COG4 Antibody

1-CSB-PA881003ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against COG4. Recognizes COG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

COG4 siRNA

20-abx912373
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COG4 siRNA

20-abx912374
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-COG4

YF-PA25945 50 ul
EUR 334
Description: Mouse polyclonal to COG4

COG4 Rabbit pAb

A16111-100ul 100 ul
EUR 308

COG4 Rabbit pAb

A16111-200ul 200 ul
EUR 459

COG4 Rabbit pAb

A16111-20ul 20 ul
EUR 183

COG4 Rabbit pAb

A16111-50ul 50 ul
EUR 223

COG4 Blocking Peptide

33R-4949 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COG4 antibody, catalog no. 70R-2996

COG4 Blocking Peptide

33R-9290 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COG4 antibody, catalog no. 70R-2997

COG4 Conjugated Antibody

C46966 100ul
EUR 397

COG4 cloning plasmid

CSB-CL881003HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1602
  • Sequence: atggtgctggggacagacatgagtgatcggagagctgcagtcatctttgcagatacacttactcttctgtttgaagggattgcccgcattgtggagacccaccagccaatagtggagacctattatgggccagggagactctataccctgatcaaatatctgcaggtggaatgtg
  • Show more
Description: A cloning plasmid for the COG4 gene.

COG4 cloning plasmid

CSB-CL881003HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1602
  • Sequence: atggtgctggggacagacatgagtgatcggagagctgcagtcatctttgcagatacacttactcttctgtttgaagggattgcccgcattgtggagacccaccagccaatagtggagacctattatgggccagggagactctataccctgatcaaatatctgcaggtggaatgtg
  • Show more
Description: A cloning plasmid for the COG4 gene.

COG4 Rabbit pAb

A7792-100ul 100 ul
EUR 308

COG4 Rabbit pAb

A7792-200ul 200 ul
EUR 459

COG4 Rabbit pAb

A7792-20ul 20 ul
EUR 183

COG4 Rabbit pAb

A7792-50ul 50 ul
EUR 223

Anti-COG4 antibody

STJ110102 100 µl
EUR 277
Description: The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.

Anti-COG4 antibody

STJ118564 100 µl
EUR 277

Anti-COG4 (3B8)

YF-MA18015 100 ug
EUR 363
Description: Mouse monoclonal to COG4

Mouse Cog4 ELISA KIT

ELI-10335m 96 Tests
EUR 865

Human COG4 ELISA KIT

ELI-25036h 96 Tests
EUR 824

Human COG4 shRNA Plasmid

20-abx958534
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse COG4 shRNA Plasmid

20-abx979538
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine COG4 ELISA KIT

ELI-50773b 96 Tests
EUR 928

COG4 Recombinant Protein (Human)

RP007582 100 ug Ask for price

COG4 Recombinant Protein (Human)

RP007585 100 ug Ask for price

COG4 Recombinant Protein (Rat)

RP195752 100 ug Ask for price

COG4 Recombinant Protein (Mouse)

RP125234 100 ug Ask for price

Polyclonal COG4 Antibody (C-term)

APR15530G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COG4 (C-term). This antibody is tested and proven to work in the following applications:

Cog4 ORF Vector (Rat) (pORF)

ORF065252 1.0 ug DNA
EUR 506

COG4 ORF Vector (Human) (pORF)

ORF002528 1.0 ug DNA
EUR 95

COG4 ORF Vector (Human) (pORF)

ORF002529 1.0 ug DNA
EUR 95

Cog4 ORF Vector (Mouse) (pORF)

ORF041746 1.0 ug DNA
EUR 506

COG4 sgRNA CRISPR Lentivector set (Human)

K0481101 3 x 1.0 ug
EUR 339

Cog4 sgRNA CRISPR Lentivector set (Rat)

K6117701 3 x 1.0 ug
EUR 339

Cog4 sgRNA CRISPR Lentivector set (Mouse)

K4851401 3 x 1.0 ug
EUR 339

COG4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0481102 1.0 ug DNA
EUR 154

COG4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0481103 1.0 ug DNA
EUR 154

COG4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0481104 1.0 ug DNA
EUR 154

Cog4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6117702 1.0 ug DNA
EUR 154

Cog4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6117703 1.0 ug DNA
EUR 154

Cog4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6117704 1.0 ug DNA
EUR 154

Cog4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4851402 1.0 ug DNA
EUR 154

Cog4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4851403 1.0 ug DNA
EUR 154

Cog4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4851404 1.0 ug DNA
EUR 154

COG4 Protein Vector (Mouse) (pPB-C-His)

PV166982 500 ng
EUR 1065

COG4 Protein Vector (Mouse) (pPB-N-His)

PV166983 500 ng
EUR 1065

COG4 Protein Vector (Mouse) (pPM-C-HA)

PV166984 500 ng
EUR 1065

COG4 Protein Vector (Mouse) (pPM-C-His)

PV166985 500 ng
EUR 1065

COG4 Protein Vector (Rat) (pPB-C-His)

PV261006 500 ng
EUR 1166

COG4 Protein Vector (Rat) (pPB-N-His)

PV261007 500 ng
EUR 1166

COG4 Protein Vector (Rat) (pPM-C-HA)

PV261008 500 ng
EUR 1166

COG4 Protein Vector (Rat) (pPM-C-His)

PV261009 500 ng
EUR 1166

COG4 Protein Vector (Human) (pPB-C-His)

PV010109 500 ng
EUR 329

COG4 Protein Vector (Human) (pPB-N-His)

PV010110 500 ng
EUR 329

COG4 Protein Vector (Human) (pPM-C-HA)

PV010111 500 ng
EUR 329

COG4 Protein Vector (Human) (pPM-C-His)

PV010112 500 ng
EUR 329

COG4 Protein Vector (Human) (pPB-C-His)

PV010113 500 ng
EUR 329

COG4 Protein Vector (Human) (pPB-N-His)

PV010114 500 ng
EUR 329

COG4 Protein Vector (Human) (pPM-C-HA)

PV010115 500 ng
EUR 329

COG4 Protein Vector (Human) (pPM-C-His)

PV010116 500 ng
EUR 329

Cog4 3'UTR GFP Stable Cell Line

TU154153 1.0 ml Ask for price

Cog4 3'UTR Luciferase Stable Cell Line

TU104153 1.0 ml Ask for price

Cog4 3'UTR Luciferase Stable Cell Line

TU202596 1.0 ml Ask for price

Cog4 3'UTR GFP Stable Cell Line

TU252596 1.0 ml Ask for price

COG4 3'UTR GFP Stable Cell Line

TU054745 1.0 ml
EUR 1394