COG4

COG4 antibody
70R-2997	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal COG4 antibody raised against the middle region of COG4

COG4 Antibody
46966-100ul	SAB	100ul	EUR 252

COG4 Antibody
1-CSB-PA881003ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against COG4. Recognizes COG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

COG4 Antibody
1-CSB-PA881003ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against COG4. Recognizes COG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

COG4 siRNA
20-abx912373	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

COG4 siRNA
20-abx912374	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-COG4
YF-PA25945	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to COG4

COG4 Rabbit pAb
A16111-100ul	Abclonal	100 ul	EUR 308

COG4 Rabbit pAb
A16111-200ul	Abclonal	200 ul	EUR 459

COG4 Rabbit pAb
A16111-20ul	Abclonal	20 ul	EUR 183

COG4 Rabbit pAb
A16111-50ul	Abclonal	50 ul	EUR 223

COG4 Blocking Peptide
33R-4949	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COG4 antibody, catalog no. 70R-2996

COG4 Blocking Peptide
33R-9290	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COG4 antibody, catalog no. 70R-2997

COG4 Conjugated Antibody
C46966	SAB	100ul	EUR 397

COG4 cloning plasmid
CSB-CL881003HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1602 Sequence: atggtgctggggacagacatgagtgatcggagagctgcagtcatctttgcagatacacttactcttctgtttgaagggattgcccgcattgtggagacccaccagccaatagtggagacctattatgggccagggagactctataccctgatcaaatatctgcaggtggaatgtg Show more
Description: A cloning plasmid for the COG4 gene.

COG4 cloning plasmid
CSB-CL881003HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1602 Sequence: atggtgctggggacagacatgagtgatcggagagctgcagtcatctttgcagatacacttactcttctgtttgaagggattgcccgcattgtggagacccaccagccaatagtggagacctattatgggccagggagactctataccctgatcaaatatctgcaggtggaatgtg Show more
Description: A cloning plasmid for the COG4 gene.

COG4 Rabbit pAb
A7792-100ul	Abclonal	100 ul	EUR 308

COG4 Rabbit pAb
A7792-200ul	Abclonal	200 ul	EUR 459

COG4 Rabbit pAb
A7792-20ul	Abclonal	20 ul	EUR 183

COG4 Rabbit pAb
A7792-50ul	Abclonal	50 ul	EUR 223

Anti-COG4 antibody
STJ110102	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.

Anti-COG4 antibody
STJ118564	St John's Laboratory	100 µl	EUR 277

Anti-COG4 (3B8)
YF-MA18015	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to COG4

Mouse Cog4 ELISA KIT
ELI-10335m	Lifescience Market	96 Tests	EUR 865

Human COG4 ELISA KIT
ELI-25036h	Lifescience Market	96 Tests	EUR 824

Human COG4 shRNA Plasmid
20-abx958534	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse COG4 shRNA Plasmid
20-abx979538	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine COG4 ELISA KIT
ELI-50773b	Lifescience Market	96 Tests	EUR 928

COG4 Recombinant Protein (Human)
RP007582	ABM	100 ug	Ask for price

COG4 Recombinant Protein (Human)
RP007585	ABM	100 ug	Ask for price

COG4 Recombinant Protein (Rat)
RP195752	ABM	100 ug	Ask for price

COG4 Recombinant Protein (Mouse)
RP125234	ABM	100 ug	Ask for price

Polyclonal COG4 Antibody (C-term)
APR15530G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COG4 (C-term). This antibody is tested and proven to work in the following applications:

Cog4 ORF Vector (Rat) (pORF)
ORF065252	ABM	1.0 ug DNA	EUR 506

COG4 ORF Vector (Human) (pORF)
ORF002528	ABM	1.0 ug DNA	EUR 95

COG4 ORF Vector (Human) (pORF)
ORF002529	ABM	1.0 ug DNA	EUR 95

Cog4 ORF Vector (Mouse) (pORF)
ORF041746	ABM	1.0 ug DNA	EUR 506

COG4 sgRNA CRISPR Lentivector set (Human)
K0481101	ABM	3 x 1.0 ug	EUR 339

Cog4 sgRNA CRISPR Lentivector set (Rat)
K6117701	ABM	3 x 1.0 ug	EUR 339

Cog4 sgRNA CRISPR Lentivector set (Mouse)
K4851401	ABM	3 x 1.0 ug	EUR 339

COG4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0481102	ABM	1.0 ug DNA	EUR 154

COG4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0481103	ABM	1.0 ug DNA	EUR 154

COG4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0481104	ABM	1.0 ug DNA	EUR 154

Cog4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6117702	ABM	1.0 ug DNA	EUR 154

Cog4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6117703	ABM	1.0 ug DNA	EUR 154

Cog4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6117704	ABM	1.0 ug DNA	EUR 154

Cog4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4851402	ABM	1.0 ug DNA	EUR 154

Cog4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4851403	ABM	1.0 ug DNA	EUR 154

Cog4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4851404	ABM	1.0 ug DNA	EUR 154

COG4 Protein Vector (Mouse) (pPB-C-His)
PV166982	ABM	500 ng	EUR 1065

COG4 Protein Vector (Mouse) (pPB-N-His)
PV166983	ABM	500 ng	EUR 1065

COG4 Protein Vector (Mouse) (pPM-C-HA)
PV166984	ABM	500 ng	EUR 1065

COG4 Protein Vector (Mouse) (pPM-C-His)
PV166985	ABM	500 ng	EUR 1065

COG4 Protein Vector (Rat) (pPB-C-His)
PV261006	ABM	500 ng	EUR 1166

COG4 Protein Vector (Rat) (pPB-N-His)
PV261007	ABM	500 ng	EUR 1166

COG4 Protein Vector (Rat) (pPM-C-HA)
PV261008	ABM	500 ng	EUR 1166

COG4 Protein Vector (Rat) (pPM-C-His)
PV261009	ABM	500 ng	EUR 1166

COG4 Protein Vector (Human) (pPB-C-His)
PV010109	ABM	500 ng	EUR 329

COG4 Protein Vector (Human) (pPB-N-His)
PV010110	ABM	500 ng	EUR 329

COG4 Protein Vector (Human) (pPM-C-HA)
PV010111	ABM	500 ng	EUR 329

COG4 Protein Vector (Human) (pPM-C-His)
PV010112	ABM	500 ng	EUR 329

COG4 Protein Vector (Human) (pPB-C-His)
PV010113	ABM	500 ng	EUR 329

COG4 Protein Vector (Human) (pPB-N-His)
PV010114	ABM	500 ng	EUR 329

COG4 Protein Vector (Human) (pPM-C-HA)
PV010115	ABM	500 ng	EUR 329

COG4 Protein Vector (Human) (pPM-C-His)
PV010116	ABM	500 ng	EUR 329

Cog4 3'UTR GFP Stable Cell Line
TU154153	ABM	1.0 ml	Ask for price

Cog4 3'UTR Luciferase Stable Cell Line
TU104153	ABM	1.0 ml	Ask for price

Cog4 3'UTR Luciferase Stable Cell Line
TU202596	ABM	1.0 ml	Ask for price

Cog4 3'UTR GFP Stable Cell Line
TU252596	ABM	1.0 ml	Ask for price

COG4 3'UTR GFP Stable Cell Line
TU054745	ABM	1.0 ml	EUR 1394