PSMD13

PSMD13 siRNA
20-abx904325	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSMD13 Antibody
ABD9093	Lifescience Market	100 ug	EUR 438

PSMD13 siRNA
20-abx930180	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSMD13 siRNA
20-abx930181	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSMD13 Antibody
45705-100ul	SAB	100ul	EUR 252

PSMD13 Antibody
45705-50ul	SAB	50ul	EUR 187

PSMD13 antibody
70R-19599	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PSMD13 antibody

PSMD13 Antibody
DF9093	Affbiotech	200ul	EUR 304
Description: PSMD13 Antibody detects endogenous levels of total PSMD13.

PSMD13 Antibody
1-CSB-PA890768ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSMD13. Recognizes PSMD13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PSMD13 Antibody
1-CSB-PA018903GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMD13. Recognizes PSMD13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

anti-PSMD13
YF-PA14147	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PSMD13

anti-PSMD13
YF-PA14148	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PSMD13

PSMD13 Conjugated Antibody
C45705	SAB	100ul	EUR 397

anti- PSMD13 antibody
FNab06885	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Uniprot ID: Q9UNM6 Gene ID: 5719 Research Area: Metabolism
Description: Antibody raised against PSMD13

PSMD13 Rabbit pAb
A12485-100ul	Abclonal	100 ul	EUR 308

PSMD13 Rabbit pAb
A12485-200ul	Abclonal	200 ul	EUR 459

PSMD13 Rabbit pAb
A12485-20ul	Abclonal	20 ul	EUR 183

PSMD13 Rabbit pAb
A12485-50ul	Abclonal	50 ul	EUR 223

PSMD13 Rabbit pAb
A6956-100ul	Abclonal	100 ul	EUR 308

PSMD13 Rabbit pAb
A6956-200ul	Abclonal	200 ul	EUR 459

PSMD13 Rabbit pAb
A6956-20ul	Abclonal	20 ul	EUR 183

PSMD13 Rabbit pAb
A6956-50ul	Abclonal	50 ul	EUR 223

PSMD13 Blocking Peptide
DF9093-BP	Affbiotech	1mg	EUR 195

PSMD13 cloning plasmid
CSB-CL890768HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1131 Sequence: atgaaggacgtaccgggcttcctacagcagagccagagctccgggcccgggcagcccgctgtgtggcaccgtctggaggagctctacacgaagaagttgtggcatcagctgacacttcaggtgcttgattttgtgcaggatccgtgctttgcccaaggagatggtctcattaagc Show more
Description: A cloning plasmid for the PSMD13 gene.

Anti-PSMD13 antibody
PAab06885	Lifescience Market	100 ug	EUR 355

Anti-PSMD13 antibody
STJ29036	St John's Laboratory	100 µl	EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Two transcripts encoding different isoforms have been described.

Anti-PSMD13 antibody
STJ114359	St John's Laboratory	100 µl	EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Two transcripts encoding different isoforms have been described.

Mouse PSMD13 shRNA Plasmid
20-abx973599	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine PSMD13 ELISA KIT
ELI-12798b	Lifescience Market	96 Tests	EUR 928

Chicken PSMD13 ELISA KIT
ELI-12799c	Lifescience Market	96 Tests	EUR 928

Human PSMD13 ELISA KIT
ELI-15653h	Lifescience Market	96 Tests	EUR 824

PSMD13 ELISA KIT|Human
EF002128	Lifescience Market	96 Tests	EUR 689

Mouse Psmd13 ELISA KIT
ELI-52404m	Lifescience Market	96 Tests	EUR 865

Human PSMD13 shRNA Plasmid
20-abx953864	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PSMD13 protein (His tag)
80R-3838	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant PSMD13 protein (His tag)

Rat PSMD13 shRNA Plasmid
20-abx990620	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PSMD13 Recombinant Protein (Human)
RP024979	ABM	100 ug	Ask for price

PSMD13 Recombinant Protein (Rat)
RP222668	ABM	100 ug	Ask for price

PSMD13 Recombinant Protein (Mouse)
RP165329	ABM	100 ug	Ask for price

Polyclonal PSMD13 Antibody (C-term)
APR05091G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMD13 (C-term). This antibody is tested and proven to work in the following applications:

PSMD13 ORF Vector (Human) (pORF)
ORF008327	ABM	1.0 ug DNA	EUR 95

Psmd13 ORF Vector (Rat) (pORF)
ORF074224	ABM	1.0 ug DNA	EUR 506

Psmd13 ORF Vector (Mouse) (pORF)
ORF055111	ABM	1.0 ug DNA	EUR 506

PSMD13 sgRNA CRISPR Lentivector set (Human)
K1743801	ABM	3 x 1.0 ug	EUR 339

Psmd13 sgRNA CRISPR Lentivector set (Rat)
K6181201	ABM	3 x 1.0 ug	EUR 339

Psmd13 sgRNA CRISPR Lentivector set (Mouse)
K3393001	ABM	3 x 1.0 ug	EUR 339

PSMD13 sgRNA CRISPR Lentivector (Human) (Target 1)
K1743802	ABM	1.0 ug DNA	EUR 154

PSMD13 sgRNA CRISPR Lentivector (Human) (Target 2)
K1743803	ABM	1.0 ug DNA	EUR 154

PSMD13 sgRNA CRISPR Lentivector (Human) (Target 3)
K1743804	ABM	1.0 ug DNA	EUR 154

Psmd13 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6181202	ABM	1.0 ug DNA	EUR 154

Psmd13 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6181203	ABM	1.0 ug DNA	EUR 154

Psmd13 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6181204	ABM	1.0 ug DNA	EUR 154

Psmd13 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3393002	ABM	1.0 ug DNA	EUR 154

Psmd13 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3393003	ABM	1.0 ug DNA	EUR 154

Psmd13 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3393004	ABM	1.0 ug DNA	EUR 154