PSMD13

PSMD13 Antibody
1-CSB-PA018903GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMD13. Recognizes PSMD13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

PSMD13 antibody
70R-19599 50 ul
EUR 435.00
Description: Rabbit polyclonal PSMD13 antibody

PSMD13 siRNA
20-abx904325
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD13 siRNA
20-abx930180
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD13 siRNA
20-abx930181
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD13 Antibody
1-CSB-PA890768ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSMD13. Recognizes PSMD13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PSMD13 Antibody
DF9093 200ul
EUR 304.00
Description: PSMD13 Antibody detects endogenous levels of total PSMD13.

PSMD13 Antibody
ABD9093 100 ug
EUR 438.00

PSMD13 Antibody
45705-100ul 100ul
EUR 252.00

PSMD13 Antibody
45705-50ul 50ul
EUR 187.00

anti-PSMD13
YF-PA14147 50 ug
EUR 363.00
Description: Mouse polyclonal to PSMD13

anti-PSMD13
YF-PA14148 50 ug
EUR 363.00
Description: Mouse polyclonal to PSMD13

PSMD13 Conjugated Antibody
C45705 100ul
EUR 397.00

PSMD13 cloning plasmid
CSB-CL890768HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1131
  • Sequence: atgaaggacgtaccgggcttcctacagcagagccagagctccgggcccgggcagcccgctgtgtggcaccgtctggaggagctctacacgaagaagttgtggcatcagctgacacttcaggtgcttgattttgtgcaggatccgtgctttgcccaaggagatggtctcattaagc
  • Show more
Description: A cloning plasmid for the PSMD13 gene.

PSMD13 Rabbit pAb
A6956-100ul 100 ul
EUR 308.00

PSMD13 Rabbit pAb
A6956-200ul 200 ul
EUR 459.00

PSMD13 Rabbit pAb
A6956-20ul 20 ul
EUR 183.00

PSMD13 Rabbit pAb
A6956-50ul 50 ul
EUR 223.00

PSMD13 Blocking Peptide
DF9093-BP 1mg
EUR 195.00

PSMD13 Rabbit pAb
A12485-100ul 100 ul
EUR 308.00

PSMD13 Rabbit pAb
A12485-200ul 200 ul
EUR 459.00

PSMD13 Rabbit pAb
A12485-20ul 20 ul
EUR 183.00

PSMD13 Rabbit pAb
A12485-50ul 50 ul
EUR 223.00

anti- PSMD13 antibody
FNab06885 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
  • Uniprot ID: Q9UNM6
  • Gene ID: 5719
  • Research Area: Metabolism
Description: Antibody raised against PSMD13

Anti-PSMD13 antibody
PAab06885 100 ug
EUR 355.00

Anti-PSMD13 antibody
STJ114359 100 µl
EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Two transcripts encoding different isoforms have been described.

Anti-PSMD13 antibody
STJ29036 100 µl
EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Two transcripts encoding different isoforms have been described.

Rat PSMD13 shRNA Plasmid
20-abx990620
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PSMD13 shRNA Plasmid
20-abx973599
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PSMD13 shRNA Plasmid
20-abx953864
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMD13 protein (His tag)
80R-3838 100 ug
EUR 327.00
Description: Purified recombinant PSMD13 protein (His tag)

Mouse Psmd13 ELISA KIT
ELI-52404m 96 Tests
EUR 865.00

PSMD13 ELISA KIT|Human
EF002128 96 Tests
EUR 689.00

Bovine PSMD13 ELISA KIT
ELI-12798b 96 Tests
EUR 928.00

Chicken PSMD13 ELISA KIT
ELI-12799c 96 Tests
EUR 928.00

Human PSMD13 ELISA KIT
ELI-15653h 96 Tests
EUR 824.00

PSMD13 Recombinant Protein (Rat)
RP222668 100 ug Ask for price

PSMD13 Recombinant Protein (Mouse)
RP165329 100 ug Ask for price

PSMD13 Recombinant Protein (Human)
RP024979 100 ug Ask for price

Polyclonal PSMD13 Antibody (C-term)
APR05091G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMD13 (C-term). This antibody is tested and proven to work in the following applications:

PSMD13 ORF Vector (Human) (pORF)
ORF008327 1.0 ug DNA
EUR 95.00

Psmd13 ORF Vector (Rat) (pORF)
ORF074224 1.0 ug DNA
EUR 506.00

Psmd13 ORF Vector (Mouse) (pORF)
ORF055111 1.0 ug DNA
EUR 506.00

Psmd13 sgRNA CRISPR Lentivector set (Rat)
K6181201 3 x 1.0 ug
EUR 339.00

Psmd13 sgRNA CRISPR Lentivector set (Mouse)
K3393001 3 x 1.0 ug
EUR 339.00

PSMD13 sgRNA CRISPR Lentivector set (Human)
K1743801 3 x 1.0 ug
EUR 339.00

Psmd13 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6181202 1.0 ug DNA
EUR 154.00

Psmd13 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6181203 1.0 ug DNA
EUR 154.00

Psmd13 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6181204 1.0 ug DNA
EUR 154.00

Psmd13 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3393002 1.0 ug DNA
EUR 154.00

Psmd13 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3393003 1.0 ug DNA
EUR 154.00

Psmd13 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3393004 1.0 ug DNA
EUR 154.00

PSMD13 sgRNA CRISPR Lentivector (Human) (Target 1)
K1743802 1.0 ug DNA
EUR 154.00

PSMD13 sgRNA CRISPR Lentivector (Human) (Target 2)
K1743803 1.0 ug DNA
EUR 154.00

PSMD13 sgRNA CRISPR Lentivector (Human) (Target 3)
K1743804 1.0 ug DNA
EUR 154.00