PSMD13 antibody

70R-19599 50 ul
EUR 435
Description: Rabbit polyclonal PSMD13 antibody

PSMD13 Antibody

45705-100ul 100ul
EUR 252

PSMD13 Antibody

45705-50ul 50ul
EUR 187

PSMD13 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSMD13. Recognizes PSMD13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PSMD13 Antibody

DF9093 200ul
EUR 304
Description: PSMD13 Antibody detects endogenous levels of total PSMD13.

PSMD13 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMD13. Recognizes PSMD13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMD13 Antibody

ABD9093 100 ug
EUR 438


YF-PA14147 50 ug
EUR 363
Description: Mouse polyclonal to PSMD13


YF-PA14148 50 ug
EUR 363
Description: Mouse polyclonal to PSMD13

PSMD13 Rabbit pAb

A12485-100ul 100 ul
EUR 308

PSMD13 Rabbit pAb

A12485-200ul 200 ul
EUR 459

PSMD13 Rabbit pAb

A12485-20ul 20 ul
EUR 183

PSMD13 Rabbit pAb

A12485-50ul 50 ul
EUR 223

PSMD13 cloning plasmid

CSB-CL890768HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1131
  • Sequence: atgaaggacgtaccgggcttcctacagcagagccagagctccgggcccgggcagcccgctgtgtggcaccgtctggaggagctctacacgaagaagttgtggcatcagctgacacttcaggtgcttgattttgtgcaggatccgtgctttgcccaaggagatggtctcattaagc
  • Show more
Description: A cloning plasmid for the PSMD13 gene.

PSMD13 Blocking Peptide

DF9093-BP 1mg
EUR 195

PSMD13 Conjugated Antibody

C45705 100ul
EUR 397

PSMD13 Rabbit pAb

A6956-100ul 100 ul
EUR 308

PSMD13 Rabbit pAb

A6956-200ul 200 ul
EUR 459

PSMD13 Rabbit pAb

A6956-20ul 20 ul
EUR 183

PSMD13 Rabbit pAb

A6956-50ul 50 ul
EUR 223

anti- PSMD13 antibody

FNab06885 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) 26S subunit, non-ATPase, 13
  • Uniprot ID: Q9UNM6
  • Gene ID: 5719
  • Research Area: Metabolism
Description: Antibody raised against PSMD13

Anti-PSMD13 antibody

PAab06885 100 ug
EUR 355

Anti-PSMD13 antibody

STJ29036 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Two transcripts encoding different isoforms have been described.

Anti-PSMD13 antibody

STJ114359 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Two transcripts encoding different isoforms have been described.

PSMD13 protein (His tag)

80R-3838 100 ug
EUR 327
Description: Purified recombinant PSMD13 protein (His tag)


ELI-12798b 96 Tests
EUR 928


ELI-12799c 96 Tests
EUR 928


ELI-15653h 96 Tests
EUR 824


EF002128 96 Tests
EUR 689

Mouse Psmd13 ELISA KIT

ELI-52404m 96 Tests
EUR 865

Rat PSMD13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PSMD13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PSMD13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMD13 Recombinant Protein (Human)

RP024979 100 ug Ask for price

PSMD13 Recombinant Protein (Mouse)

RP165329 100 ug Ask for price

PSMD13 Recombinant Protein (Rat)

RP222668 100 ug Ask for price

Polyclonal PSMD13 Antibody (C-term)

APR05091G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMD13 (C-term). This antibody is tested and proven to work in the following applications:

Psmd13 ORF Vector (Rat) (pORF)

ORF074224 1.0 ug DNA
EUR 506

PSMD13 ORF Vector (Human) (pORF)

ORF008327 1.0 ug DNA
EUR 95

Psmd13 ORF Vector (Mouse) (pORF)

ORF055111 1.0 ug DNA
EUR 506

Psmd13 sgRNA CRISPR Lentivector set (Rat)

K6181201 3 x 1.0 ug
EUR 339

Psmd13 sgRNA CRISPR Lentivector set (Mouse)

K3393001 3 x 1.0 ug
EUR 339

PSMD13 sgRNA CRISPR Lentivector set (Human)

K1743801 3 x 1.0 ug
EUR 339

Psmd13 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6181202 1.0 ug DNA
EUR 154

Psmd13 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6181203 1.0 ug DNA
EUR 154

Psmd13 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6181204 1.0 ug DNA
EUR 154

Psmd13 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3393002 1.0 ug DNA
EUR 154

Psmd13 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3393003 1.0 ug DNA
EUR 154

Psmd13 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3393004 1.0 ug DNA
EUR 154

PSMD13 sgRNA CRISPR Lentivector (Human) (Target 1)

K1743802 1.0 ug DNA
EUR 154

PSMD13 sgRNA CRISPR Lentivector (Human) (Target 2)

K1743803 1.0 ug DNA
EUR 154

PSMD13 sgRNA CRISPR Lentivector (Human) (Target 3)

K1743804 1.0 ug DNA
EUR 154