RPL39L Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

RPL39L Antibody

CSB-PA983842-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

RPL39L Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

RPL39L Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


PVT12313 2 ug
EUR 391

anti- RPL39L antibody

FNab07439 100µg
EUR 585
  • Immunogen: ribosomal protein L39-like
  • Uniprot ID: Q96EH5
  • Gene ID: 116832
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against RPL39L

RPL39L Polyclonal Antibody

A60686 100 µg
EUR 570.55
Description: Ask the seller for details

RPL39L cloning plasmid

CSB-CL850285HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 156
  • Sequence: atgtcttctcacaagactttcaccattaagcgattcctggccaagaaacaaaagcaaaatcgtcccatcccccagtggattcagatgaaacctggtagtaaaatcaggtacaactccaaaaggaggcattggagaagaaccaagctgggtctataa
Description: A cloning plasmid for the RPL39L gene.

Anti-RPL39L antibody

PAab07439 100 ug
EUR 412

Human RPL39L shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002597 96 Tests
EUR 689

RPL39L Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL39L Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL39L Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL39L Recombinant Protein (Human)

RP027001 100 ug Ask for price

RPL39L Recombinant Protein (Mouse)

RP169094 100 ug Ask for price

Anti-RPL39L (4A8-1B6)

YF-MA11735 100 ug
EUR 363
Description: Mouse monoclonal to RPL39L

RPL39L Polyclonal Antibody, Biotin Conjugated

A60687 100 µg
EUR 570.55
Description: The best epigenetics products

RPL39L Polyclonal Antibody, FITC Conjugated

A60688 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL39L Polyclonal Antibody, HRP Conjugated

A60689 100 µg
EUR 570.55
Description: fast delivery possible

RPL39L ORF Vector (Human) (pORF)

ORF009001 1.0 ug DNA
EUR 95

Rpl39l ORF Vector (Mouse) (pORF)

ORF056366 1.0 ug DNA
EUR 506

Ribosomal Protein L39 Like (RPL39L) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody

abx330374-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody

abx237439-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPL39L sgRNA CRISPR Lentivector set (Human)

K1989701 3 x 1.0 ug
EUR 339

Rpl39l sgRNA CRISPR Lentivector set (Mouse)

K3671901 3 x 1.0 ug
EUR 339

Ribosomal Protein L39 Like (RPL39L) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPL39L sgRNA CRISPR Lentivector (Human) (Target 1)

K1989702 1.0 ug DNA
EUR 154

RPL39L sgRNA CRISPR Lentivector (Human) (Target 2)

K1989703 1.0 ug DNA
EUR 154

RPL39L sgRNA CRISPR Lentivector (Human) (Target 3)

K1989704 1.0 ug DNA
EUR 154

Rpl39l sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3671902 1.0 ug DNA
EUR 154

Rpl39l sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3671903 1.0 ug DNA
EUR 154

Rpl39l sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3671904 1.0 ug DNA
EUR 154

RPL39L Protein Vector (Human) (pPB-C-His)

PV036001 500 ng
EUR 329

RPL39L Protein Vector (Human) (pPB-N-His)

PV036002 500 ng
EUR 329

RPL39L Protein Vector (Human) (pPM-C-HA)

PV036003 500 ng
EUR 329

RPL39L Protein Vector (Human) (pPM-C-His)

PV036004 500 ng
EUR 329

RPL39L Protein Vector (Mouse) (pPB-C-His)

PV225462 500 ng
EUR 603

RPL39L Protein Vector (Mouse) (pPB-N-His)

PV225463 500 ng
EUR 603

RPL39L Protein Vector (Mouse) (pPM-C-HA)

PV225464 500 ng
EUR 603

RPL39L Protein Vector (Mouse) (pPM-C-His)

PV225465 500 ng
EUR 603

Rpl39l 3'UTR GFP Stable Cell Line

TU168108 1.0 ml Ask for price

RPL39L 3'UTR Luciferase Stable Cell Line

TU021576 1.0 ml
EUR 1394

Rpl39l 3'UTR Luciferase Stable Cell Line

TU118108 1.0 ml Ask for price

RPL39L 3'UTR GFP Stable Cell Line

TU071576 1.0 ml
EUR 1394

Human Ribosomal Protein L39 Like (RPL39L) ELISA Kit

abx382923-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human 60S ribosomal protein L39- like, RPL39L ELISA KIT

ELI-18047h 96 Tests
EUR 824

RPL39L sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1989705 3 x 1.0 ug
EUR 376

Rpl39l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3671905 3 x 1.0 ug
EUR 376

RPL39L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1989706 1.0 ug DNA
EUR 167

RPL39L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1989707 1.0 ug DNA
EUR 167

RPL39L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1989708 1.0 ug DNA
EUR 167

Rpl39l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3671906 1.0 ug DNA
EUR 167

Rpl39l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3671907 1.0 ug DNA
EUR 167

Rpl39l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3671908 1.0 ug DNA
EUR 167