RPL39L

RPL39L Antibody
CSB-PA983842-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

RPL39L Antibody
CSB-PA983842-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

RPL39L Antibody
1-CSB-PA006881	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

RPL39L siRNA
20-abx931977	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pENTR223-RPL39L
PVT12313	Lifescience Market	2 ug	EUR 391

RPL39L cloning plasmid
CSB-CL850285HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 156 Sequence: atgtcttctcacaagactttcaccattaagcgattcctggccaagaaacaaaagcaaaatcgtcccatcccccagtggattcagatgaaacctggtagtaaaatcaggtacaactccaaaaggaggcattggagaagaaccaagctgggtctataa
Description: A cloning plasmid for the RPL39L gene.

RPL39L Polyclonal Antibody
A60686	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

anti- RPL39L antibody
FNab07439	FN Test	100µg	EUR 585
Immunogen: ribosomal protein L39-like Uniprot ID: Q96EH5 Gene ID: 116832 Research Area: Metabolism, Developmental biology
Description: Antibody raised against RPL39L

Anti-RPL39L antibody
PAab07439	Lifescience Market	100 ug	EUR 412

RPL39L Antibody, HRP conjugated
1-CSB-PA850285LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL39L Antibody, FITC conjugated
1-CSB-PA850285LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL39L Antibody, Biotin conjugated
1-CSB-PA850285LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL39L. Recognizes RPL39L from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL39L ELISA KIT|Human
EF002597	Lifescience Market	96 Tests	EUR 689

Human RPL39L shRNA Plasmid
20-abx964530	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL39L Recombinant Protein (Human)
RP027001	ABM	100 ug	Ask for price

RPL39L Recombinant Protein (Mouse)
RP169094	ABM	100 ug	Ask for price

Anti-RPL39L (4A8-1B6)
YF-MA11735	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RPL39L

RPL39L Polyclonal Antibody, Biotin Conjugated
A60687	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RPL39L Polyclonal Antibody, FITC Conjugated
A60688	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RPL39L Polyclonal Antibody, HRP Conjugated
A60689	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RPL39L ORF Vector (Human) (pORF)
ORF009001	ABM	1.0 ug DNA	EUR 95

Rpl39l ORF Vector (Mouse) (pORF)
ORF056366	ABM	1.0 ug DNA	EUR 506

Ribosomal Protein L39 Like (RPL39L) Antibody
20-abx014128	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody
abx237439-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody
abx330374-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody
20-abx323037	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody
20-abx301596	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rpl39l sgRNA CRISPR Lentivector set (Mouse)
K3671901	ABM	3 x 1.0 ug	EUR 339

RPL39L sgRNA CRISPR Lentivector set (Human)
K1989701	ABM	3 x 1.0 ug	EUR 339

Ribosomal Protein L39 Like (RPL39L) Antibody (HRP)
20-abx310031	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody (FITC)
20-abx310032	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L39 Like (RPL39L) Antibody (Biotin)
20-abx310033	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rpl39l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3671902	ABM	1.0 ug DNA	EUR 154

Rpl39l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3671903	ABM	1.0 ug DNA	EUR 154

Rpl39l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3671904	ABM	1.0 ug DNA	EUR 154

RPL39L sgRNA CRISPR Lentivector (Human) (Target 1)
K1989702	ABM	1.0 ug DNA	EUR 154

RPL39L sgRNA CRISPR Lentivector (Human) (Target 2)
K1989703	ABM	1.0 ug DNA	EUR 154

RPL39L sgRNA CRISPR Lentivector (Human) (Target 3)
K1989704	ABM	1.0 ug DNA	EUR 154

RPL39L Protein Vector (Mouse) (pPB-C-His)
PV225462	ABM	500 ng	EUR 603

RPL39L Protein Vector (Mouse) (pPB-N-His)
PV225463	ABM	500 ng	EUR 603

RPL39L Protein Vector (Mouse) (pPM-C-HA)
PV225464	ABM	500 ng	EUR 603

RPL39L Protein Vector (Mouse) (pPM-C-His)
PV225465	ABM	500 ng	EUR 603

RPL39L Protein Vector (Human) (pPB-C-His)
PV036001	ABM	500 ng	EUR 329

RPL39L Protein Vector (Human) (pPB-N-His)
PV036002	ABM	500 ng	EUR 329

RPL39L Protein Vector (Human) (pPM-C-HA)
PV036003	ABM	500 ng	EUR 329

RPL39L Protein Vector (Human) (pPM-C-His)
PV036004	ABM	500 ng	EUR 329

Rpl39l 3'UTR Luciferase Stable Cell Line
TU118108	ABM	1.0 ml	Ask for price

Rpl39l 3'UTR GFP Stable Cell Line
TU168108	ABM	1.0 ml	Ask for price

RPL39L 3'UTR GFP Stable Cell Line
TU071576	ABM	1.0 ml	EUR 1394

RPL39L 3'UTR Luciferase Stable Cell Line
TU021576	ABM	1.0 ml	EUR 1394

Human Ribosomal Protein L39 Like (RPL39L) ELISA Kit
abx382923-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human 60S ribosomal protein L39- like, RPL39L ELISA KIT
ELI-18047h	Lifescience Market	96 Tests	EUR 824

Rpl39l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3671905	ABM	3 x 1.0 ug	EUR 376

RPL39L sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1989705	ABM	3 x 1.0 ug	EUR 376

Rpl39l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3671906	ABM	1.0 ug DNA	EUR 167

Rpl39l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3671907	ABM	1.0 ug DNA	EUR 167

Rpl39l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3671908	ABM	1.0 ug DNA	EUR 167

RPL39L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1989706	ABM	1.0 ug DNA	EUR 167

RPL39L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1989707	ABM	1.0 ug DNA	EUR 167

RPL39L sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1989708	ABM	1.0 ug DNA	EUR 167