A4GNT

A4GNT antibody
70R-34020 100 ug
EUR 327.00
Description: Rabbit polyclonal A4GNT antibody

A4GNT antibody
70R-36130 100 ug
EUR 349.00
Description: Rabbit polyclonal A4GNT antibody

A4GNT antibody
70R-7408 50 ug
EUR 467.00
Description: Rabbit polyclonal A4GNT antibody raised against the N terminal of A4GNT

A4GNT antibody
70R-7409 50 ug
EUR 467.00
Description: Rabbit polyclonal A4GNT antibody raised against the C terminal of A4GNT

A4GNT antibody
70R-50979 100 ul
EUR 244.00
Description: Purified Polyclonal A4GNT antibody

A4GNT Antibody
ABD3762 100 ug
EUR 438.00

A4GNT Antibody
1-CSB-PA001009LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

A4GNT Antibody
1-CSB-PA020263
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

A4GNT Antibody
1-CSB-PA072731
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

A4GNT Antibody
CSB-PA797885-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

A4GNT Antibody
CSB-PA797885-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

A4GNT Antibody
1-CSB-PA703896
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

A4GNT Antibody
DF3762 200ul
EUR 304.00
Description: A4GNT Antibody detects endogenous levels of total A4GNT.

A4GNT Antibody
34406-100ul 100ul
EUR 252.00

A4GNT Antibody
34406-50ul 50ul
EUR 187.00

A4GNT Polyclonal Antibody
A62026 100 µg
EUR 570.55
Description: fast delivery possible

A4GNT Rabbit pAb
A12366-100ul 100 ul
EUR 308.00

A4GNT Rabbit pAb
A12366-200ul 200 ul
EUR 459.00

A4GNT Rabbit pAb
A12366-20ul 20 ul
EUR 183.00

A4GNT Rabbit pAb
A12366-50ul 50 ul
EUR 223.00

A4GNT Blocking Peptide
DF3762-BP 1mg
EUR 195.00

A4GNT cloning plasmid
CSB-CL001009HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1023
  • Sequence: ATGCGGAAGGAGCTCCAGCTCTCCCTGTCAGTCACCTTGCTGCTTGTCTGTGGCTTCCTCTACCAGTTCACCCTGAAGTCCAGCTGCCTCTTCTGCTTGCCTTCTTTCAAGTCCCACCAGGGGCTGGAAGCCCTCCTGAGCCACAGACGTGGCATTGTGTTTCTAGAGACCTCAG
  • Show more
Description: A cloning plasmid for the A4GNT gene.

A4GNT Blocking Peptide
33R-5167 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of A4GNT antibody, catalog no. 70R-7408

A4GNT Blocking Peptide
33R-6732 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of A4GNT antibody, catalog no. 70R-7409

A4GNT Polyclonal Antibody
E-AB-10689-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of
  • Show more
Description: Rabbit antibody against Human A4GNT for IHC,ELISA applications.

A4GNT Polyclonal Antibody
E-AB-10689-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of
  • Show more
Description: Rabbit antibody against Human A4GNT for IHC,ELISA applications.

A4GNT Polyclonal Antibody
E-AB-10689-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of
  • Show more
Description: Rabbit antibody against Human A4GNT for IHC,ELISA applications.

A4GNT Blocking Peptide
20-abx063854
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Polyclonal A4GNT Antibody
APG01408G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human A4GNT . This antibody is tested and proven to work in the following applications:

A4GNT Conjugated Antibody
C34406 100ul
EUR 397.00

Anti-A4GNT antibody
PAab00015 100 ug
EUR 355.00

anti- A4GNT antibody
FNab00015 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • Immunogen: alpha-1,4-N-acetylglucosaminyltransferase
  • Uniprot ID: Q9UNA3
  • Gene ID: 51146
  • Research Area: Metabolism
Description: Antibody raised against A4GNT

Anti-A4GNT antibody
STJ114244 100 µl
EUR 277.00
Description: This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of N-acetylglucosamine (GlcNAc) to core 2 branched O-glycans. It forms a unique glycan, GlcNAcalpha1-->4Galbeta-->R and is largely associated with the Golgi apparatus membrane.

Human A4GNT shRNA Plasmid
20-abx959561
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

A4GNT Antibody, HRP conjugated
1-CSB-PA001009LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

A4GNT Antibody, FITC conjugated
1-CSB-PA001009LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

A4GNT Antibody, Biotin conjugated
1-CSB-PA001009LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against A4GNT. Recognizes A4GNT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

A4GNT ELISA KIT|Human
EF007514 96 Tests
EUR 689.00

A4GNT Recombinant Protein (Human)
RP036352 100 ug Ask for price

A4GNT Recombinant Protein (Mouse)
RP113024 100 ug Ask for price

Anti-A4GNT / alpha4GNT antibody
STJ72083 100 µg
EUR 359.00

A4GNT Polyclonal Antibody, HRP Conjugated
A62027 100 µg
EUR 570.55
Description: reagents widely cited

A4GNT Polyclonal Antibody, FITC Conjugated
A62028 100 µg
EUR 570.55
Description: Ask the seller for details

A4GNT Polyclonal Antibody, Biotin Conjugated
A62029 100 µg
EUR 570.55
Description: The best epigenetics products

A4GNT ORF Vector (Human) (pORF)
ORF012118 1.0 ug DNA
EUR 354.00

A4gnt ORF Vector (Mouse) (pORF)
ORF037676 1.0 ug DNA
EUR 506.00

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody
abx330783-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody
abx430472-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody
20-abx324703
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Alpha-1,4-N-Acetylglucosaminyltransferase (A4GNT) Antibody
20-abx210468
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.