GBF1

GBF1 Antibody

DF13034 200ul
EUR 304
Description: GBF1 Antibody detects endogenous levels of GBF1.

GBF1 siRNA

20-abx917647
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GBF1 Polyclonal Antibody

27714-100ul 100ul
EUR 252

GBF1 Polyclonal Antibody

27714-50ul 50ul
EUR 187

GBF1 Polyclonal Antibody

31557-100ul 100ul
EUR 252

GBF1 Polyclonal Antibody

31557-50ul 50ul
EUR 187

GBF1 Rabbit pAb

A12539-100ul 100 ul
EUR 308

GBF1 Rabbit pAb

A12539-200ul 200 ul
EUR 459

GBF1 Rabbit pAb

A12539-20ul 20 ul
EUR 183

GBF1 Rabbit pAb

A12539-50ul 50 ul
EUR 223

GBF1 Blocking Peptide

DF13034-BP 1mg
EUR 195

GBF1 cloning plasmid

CSB-CL846077HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5568
  • Sequence: ATGGTGGATAAGAATATTTACATCATTCAAGGGGAGATTAACATTGTGGTTGGGGCCATCAAACGAAATGCCCGATGGAGCACCCATACACCACTGGATGAAGAACGGGATCCTCTGCTGCATAGTTTCGGTCATCTAAAGGAGGTTTTAAACAGTATAACAGAACTCTCAGAAA
  • Show more
Description: A cloning plasmid for the GBF1 gene.

GBF1 Rabbit pAb

A8468-100ul 100 ul
EUR 308

GBF1 Rabbit pAb

A8468-200ul 200 ul
EUR 459

GBF1 Rabbit pAb

A8468-20ul 20 ul
EUR 183

GBF1 Rabbit pAb

A8468-50ul 50 ul
EUR 223

anti- GBF1 antibody

FNab03372 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: golgi-specific brefeldin A resistant guanine nucleotide exchange factor 1
  • Uniprot ID: Q92538
  • Gene ID: 8729
  • Research Area: Metabolism
Description: Antibody raised against GBF1

Anti-GBF1 antibody

PAab03372 100 ug
EUR 412

Anti-GBF1 antibody

STJ110766 100 µl
EUR 277
Description: This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene.

Anti-GBF1 antibody

STJ114413 100 µl
EUR 277
Description: This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene.

Anti-GBF1 (4B2)

YF-MA20463 100 ug
EUR 363
Description: Mouse monoclonal to GBF1

Human GBF1 ELISA KIT

ELI-08180h 96 Tests
EUR 824

GBF1 ELISA KIT|Human

EF009795 96 Tests
EUR 689

GBF1 Polyclonal Conjugated Antibody

C31557 100ul
EUR 397

GBF1 Polyclonal Conjugated Antibody

C27714 100ul
EUR 397

Human GBF1 shRNA Plasmid

20-abx955749
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Gbf1 ORF Vector (Rat) (pORF)

ORF067443 1.0 ug DNA
EUR 2080

GBF1 ORF Vector (Human) (pORF)

ORF013138 1.0 ug DNA
EUR 354

Gbf1 ORF Vector (Mouse) (pORF)

ORF045346 1.0 ug DNA
EUR 1572

Gbf1 sgRNA CRISPR Lentivector set (Rat)

K7600601 3 x 1.0 ug
EUR 339

GBF1 sgRNA CRISPR Lentivector set (Human)

K0844501 3 x 1.0 ug
EUR 339

Gbf1 sgRNA CRISPR Lentivector set (Mouse)

K4699901 3 x 1.0 ug
EUR 339

Gbf1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7600602 1.0 ug DNA
EUR 154

Gbf1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7600603 1.0 ug DNA
EUR 154

Gbf1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7600604 1.0 ug DNA
EUR 154

GBF1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0844502 1.0 ug DNA
EUR 154

GBF1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0844503 1.0 ug DNA
EUR 154

GBF1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0844504 1.0 ug DNA
EUR 154

Gbf1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4699902 1.0 ug DNA
EUR 154

Gbf1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4699903 1.0 ug DNA
EUR 154

Gbf1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4699904 1.0 ug DNA
EUR 154

GBF1 Protein Vector (Rat) (pPB-C-His)

PV269770 500 ng
EUR 3087

GBF1 Protein Vector (Rat) (pPB-N-His)

PV269771 500 ng
EUR 3087

GBF1 Protein Vector (Rat) (pPM-C-HA)

PV269772 500 ng
EUR 3087

GBF1 Protein Vector (Rat) (pPM-C-His)

PV269773 500 ng
EUR 3087

GBF1 Protein Vector (Mouse) (pPB-C-His)

PV181382 500 ng
EUR 3087

GBF1 Protein Vector (Mouse) (pPB-N-His)

PV181383 500 ng
EUR 3087

GBF1 Protein Vector (Mouse) (pPM-C-HA)

PV181384 500 ng
EUR 3087

GBF1 Protein Vector (Mouse) (pPM-C-His)

PV181385 500 ng
EUR 3087

GBF1 Protein Vector (Human) (pPB-C-His)

PV052549 500 ng
EUR 481

GBF1 Protein Vector (Human) (pPB-N-His)

PV052550 500 ng
EUR 481

GBF1 Protein Vector (Human) (pPM-C-HA)

PV052551 500 ng
EUR 481

GBF1 Protein Vector (Human) (pPM-C-His)

PV052552 500 ng
EUR 481

Gbf1 3'UTR Luciferase Stable Cell Line

TU106941 1.0 ml Ask for price

Gbf1 3'UTR GFP Stable Cell Line

TU156941 1.0 ml Ask for price

Gbf1 3'UTR Luciferase Stable Cell Line

TU204984 1.0 ml Ask for price

Gbf1 3'UTR GFP Stable Cell Line

TU254984 1.0 ml Ask for price

GBF1 3'UTR GFP Stable Cell Line

TU058653 1.0 ml
EUR 1394

GBF1 3'UTR Luciferase Stable Cell Line

TU008653 1.0 ml
EUR 1394

GBF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV640003 1.0 ug DNA
EUR 2873

GBF1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV640007 1.0 ug DNA
EUR 2873

GBF1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV640008 1.0 ug DNA
EUR 2873

Gbf1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7600605 3 x 1.0 ug
EUR 376

GBF1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0844505 3 x 1.0 ug
EUR 376

Gbf1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4699905 3 x 1.0 ug
EUR 376

GBF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV640004 1.0 ug DNA
EUR 2873

GBF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV640005 1.0 ug DNA
EUR 2931

GBF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV640006 1.0 ug DNA
EUR 2931

Gbf1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7600606 1.0 ug DNA
EUR 167

Gbf1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7600607 1.0 ug DNA
EUR 167