GBF1

GBF1 Antibody
DF13034	Affbiotech	200ul	EUR 304
Description: GBF1 Antibody detects endogenous levels of GBF1.

GBF1 siRNA
20-abx917647	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GBF1 Polyclonal Antibody
27714-100ul	SAB	100ul	EUR 252

GBF1 Polyclonal Antibody
27714-50ul	SAB	50ul	EUR 187

GBF1 Polyclonal Antibody
31557-100ul	SAB	100ul	EUR 252

GBF1 Polyclonal Antibody
31557-50ul	SAB	50ul	EUR 187

GBF1 Rabbit pAb
A12539-100ul	Abclonal	100 ul	EUR 308

GBF1 Rabbit pAb
A12539-200ul	Abclonal	200 ul	EUR 459

GBF1 Rabbit pAb
A12539-20ul	Abclonal	20 ul	EUR 183

GBF1 Rabbit pAb
A12539-50ul	Abclonal	50 ul	EUR 223

GBF1 Blocking Peptide
DF13034-BP	Affbiotech	1mg	EUR 195

GBF1 cloning plasmid
CSB-CL846077HU-10ug	Cusabio	10ug	EUR 2770
Formulation: 10 μg plasmid + 200μl Glycerol Length: 5568 Sequence: ATGGTGGATAAGAATATTTACATCATTCAAGGGGAGATTAACATTGTGGTTGGGGCCATCAAACGAAATGCCCGATGGAGCACCCATACACCACTGGATGAAGAACGGGATCCTCTGCTGCATAGTTTCGGTCATCTAAAGGAGGTTTTAAACAGTATAACAGAACTCTCAGAAA Show more
Description: A cloning plasmid for the GBF1 gene.

GBF1 Rabbit pAb
A8468-100ul	Abclonal	100 ul	EUR 308

GBF1 Rabbit pAb
A8468-200ul	Abclonal	200 ul	EUR 459

GBF1 Rabbit pAb
A8468-20ul	Abclonal	20 ul	EUR 183

GBF1 Rabbit pAb
A8468-50ul	Abclonal	50 ul	EUR 223

anti- GBF1 antibody
FNab03372	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 Immunogen: golgi-specific brefeldin A resistant guanine nucleotide exchange factor 1 Uniprot ID: Q92538 Gene ID: 8729 Research Area: Metabolism
Description: Antibody raised against GBF1

Anti-GBF1 antibody
PAab03372	Lifescience Market	100 ug	EUR 412

Anti-GBF1 antibody
STJ110766	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene.

Anti-GBF1 antibody
STJ114413	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene.

Anti-GBF1 (4B2)
YF-MA20463	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GBF1

Human GBF1 ELISA KIT
ELI-08180h	Lifescience Market	96 Tests	EUR 824

GBF1 ELISA KIT|Human
EF009795	Lifescience Market	96 Tests	EUR 689

GBF1 Polyclonal Conjugated Antibody
C31557	SAB	100ul	EUR 397

GBF1 Polyclonal Conjugated Antibody
C27714	SAB	100ul	EUR 397

Human GBF1 shRNA Plasmid
20-abx955749	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Gbf1 ORF Vector (Rat) (pORF)
ORF067443	ABM	1.0 ug DNA	EUR 2080

GBF1 ORF Vector (Human) (pORF)
ORF013138	ABM	1.0 ug DNA	EUR 354

Gbf1 ORF Vector (Mouse) (pORF)
ORF045346	ABM	1.0 ug DNA	EUR 1572

Gbf1 sgRNA CRISPR Lentivector set (Rat)
K7600601	ABM	3 x 1.0 ug	EUR 339

GBF1 sgRNA CRISPR Lentivector set (Human)
K0844501	ABM	3 x 1.0 ug	EUR 339

Gbf1 sgRNA CRISPR Lentivector set (Mouse)
K4699901	ABM	3 x 1.0 ug	EUR 339

Gbf1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7600602	ABM	1.0 ug DNA	EUR 154

Gbf1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7600603	ABM	1.0 ug DNA	EUR 154

Gbf1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7600604	ABM	1.0 ug DNA	EUR 154

GBF1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0844502	ABM	1.0 ug DNA	EUR 154

GBF1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0844503	ABM	1.0 ug DNA	EUR 154

GBF1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0844504	ABM	1.0 ug DNA	EUR 154

Gbf1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4699902	ABM	1.0 ug DNA	EUR 154

Gbf1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4699903	ABM	1.0 ug DNA	EUR 154

Gbf1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4699904	ABM	1.0 ug DNA	EUR 154

GBF1 Protein Vector (Rat) (pPB-C-His)
PV269770	ABM	500 ng	EUR 3087

GBF1 Protein Vector (Rat) (pPB-N-His)
PV269771	ABM	500 ng	EUR 3087

GBF1 Protein Vector (Rat) (pPM-C-HA)
PV269772	ABM	500 ng	EUR 3087

GBF1 Protein Vector (Rat) (pPM-C-His)
PV269773	ABM	500 ng	EUR 3087

GBF1 Protein Vector (Mouse) (pPB-C-His)
PV181382	ABM	500 ng	EUR 3087

GBF1 Protein Vector (Mouse) (pPB-N-His)
PV181383	ABM	500 ng	EUR 3087

GBF1 Protein Vector (Mouse) (pPM-C-HA)
PV181384	ABM	500 ng	EUR 3087

GBF1 Protein Vector (Mouse) (pPM-C-His)
PV181385	ABM	500 ng	EUR 3087

GBF1 Protein Vector (Human) (pPB-C-His)
PV052549	ABM	500 ng	EUR 481

GBF1 Protein Vector (Human) (pPB-N-His)
PV052550	ABM	500 ng	EUR 481

GBF1 Protein Vector (Human) (pPM-C-HA)
PV052551	ABM	500 ng	EUR 481

GBF1 Protein Vector (Human) (pPM-C-His)
PV052552	ABM	500 ng	EUR 481

Gbf1 3'UTR Luciferase Stable Cell Line
TU106941	ABM	1.0 ml	Ask for price

Gbf1 3'UTR GFP Stable Cell Line
TU156941	ABM	1.0 ml	Ask for price

Gbf1 3'UTR Luciferase Stable Cell Line
TU204984	ABM	1.0 ml	Ask for price

Gbf1 3'UTR GFP Stable Cell Line
TU254984	ABM	1.0 ml	Ask for price

GBF1 3'UTR GFP Stable Cell Line
TU058653	ABM	1.0 ml	EUR 1394

GBF1 3'UTR Luciferase Stable Cell Line
TU008653	ABM	1.0 ml	EUR 1394

GBF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV640003	ABM	1.0 ug DNA	EUR 2873

GBF1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV640007	ABM	1.0 ug DNA	EUR 2873

GBF1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV640008	ABM	1.0 ug DNA	EUR 2873

Gbf1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7600605	ABM	3 x 1.0 ug	EUR 376

GBF1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0844505	ABM	3 x 1.0 ug	EUR 376

Gbf1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4699905	ABM	3 x 1.0 ug	EUR 376

GBF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV640004	ABM	1.0 ug DNA	EUR 2873

GBF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV640005	ABM	1.0 ug DNA	EUR 2931

GBF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV640006	ABM	1.0 ug DNA	EUR 2931

Gbf1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7600606	ABM	1.0 ug DNA	EUR 167

Gbf1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7600607	ABM	1.0 ug DNA	EUR 167