Human Mannose Phosphate Isomerase (MPI) ELISA Kit

DLR-MPI-Hu-96T 96T
EUR 673
  • Should the Human Mannose Phosphate Isomerase (MPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mannose Phosphate Isomerase (MPI) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Mannose Phosphate Isomerase (MPI) ELISA Kit

RD-MPI-Hu-48Tests 48 Tests
EUR 521

Human Mannose Phosphate Isomerase (MPI) ELISA Kit

RD-MPI-Hu-96Tests 96 Tests
EUR 723

Human Mannose Phosphate Isomerase (MPI) ELISA Kit

RDR-MPI-Hu-48Tests 48 Tests
EUR 544

Human Mannose Phosphate Isomerase (MPI) ELISA Kit

RDR-MPI-Hu-96Tests 96 Tests
EUR 756

Mpi/ Rat Mpi ELISA Kit

ELI-23457r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


EUR 251


EUR 164


B3706-1 1 mg
EUR 112
Description: MPI-0479605 is a small-molecule inhibitor of the Mitotic Kinase Mps1 with IC50 value of 1.8nM [1].MPI-0479605 is a selective and ATP competitive inhibitor of Mps1.


B3706-10 10 mg
EUR 551
Description: MPI-0479605 is a small-molecule inhibitor of the Mitotic Kinase Mps1 with IC50 value of 1.8nM [1].MPI-0479605 is a selective and ATP competitive inhibitor of Mps1.


B3706-25 25 mg
EUR 1146
Description: MPI-0479605 is a small-molecule inhibitor of the Mitotic Kinase Mps1 with IC50 value of 1.8nM [1].MPI-0479605 is a selective and ATP competitive inhibitor of Mps1.


B3706-5 5 mg
EUR 315
Description: MPI-0479605 is a small-molecule inhibitor of the Mitotic Kinase Mps1 with IC50 value of 1.8nM [1].MPI-0479605 is a selective and ATP competitive inhibitor of Mps1.


C3296-10 10 mg
EUR 373
Description: EC50: 2 nM for caspase activationMPI-0441138 is an inducer of apoptosis and growth inhibition.Apoptosis or programmed cell death is a process that organisms use to eliminate excessive cells and to control cell numbers.


C3296-25 25 mg
EUR 757
Description: EC50: 2 nM for caspase activationMPI-0441138 is an inducer of apoptosis and growth inhibition.Apoptosis or programmed cell death is a process that organisms use to eliminate excessive cells and to control cell numbers.


C3296-5 5 mg
EUR 232
Description: EC50: 2 nM for caspase activationMPI-0441138 is an inducer of apoptosis and growth inhibition.Apoptosis or programmed cell death is a process that organisms use to eliminate excessive cells and to control cell numbers.


HY-12660 5mg
EUR 340


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


EUR 588


EUR 185

MPI antibody

10R-10801 100 ug
EUR 381
Description: Mouse monoclonal MPI antibody

MPI antibody

22051-100ul 100ul
EUR 390

MPI antibody

22328-100ul 100ul
EUR 390

MPI antibody

70R-18576 50 ul
EUR 435
Description: Rabbit polyclonal MPI antibody

MPI antibody

70R-12742 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal MPI antibody

MPI antibody

70R-13607 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal MPI antibody

MPI Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MPI Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MPI Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200


PVT12692 2 ug
EUR 391

MPI cloning plasmid

CSB-CL014754HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1089
  • Sequence: atggccgctccgcgagtattcccactttcctgtgcggtgcagcagtatgcctgggggaagatgggttccaacagcgaagtggcgcggctgttggccagcagtgatccactggcccagatcgcagaggacaagccttatgcagagttgtggatggggactcacccccgaggggatg
  • Show more
Description: A cloning plasmid for the MPI gene.

MPI cloning plasmid

CSB-CL014754HU2-10ug 10ug
EUR 465
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggccgctccgcgagtattcccactttcctgtgcggtgcagcagtatgcctgggggaagatgggttccaacagcgaagtggcgcggctgttggccagcagtgatccactggcccagatcgcagaggacaagccttatgcagagttgtggatggggactcacccccgaggggatg
  • Show more
Description: A cloning plasmid for the MPI gene.

anti- MPI antibody

FNab05283 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: mannose phosphate isomerase
  • Uniprot ID: P34949
  • Gene ID: 4351
  • Research Area: Metabolism
Description: Antibody raised against MPI

MPI Rabbit pAb

A7319-100ul 100 ul
EUR 308

MPI Rabbit pAb

A7319-200ul 200 ul
EUR 459

MPI Rabbit pAb

A7319-20ul 20 ul
EUR 183

MPI Rabbit pAb

A7319-50ul 50 ul
EUR 223

Human MPI Antibody

32207-05111 150 ug
EUR 261

MPI Monoclonal Antibody

27091-100ul 100ul
EUR 252

MPI Monoclonal Antibody

27091-50ul 50ul
EUR 187

Anti-MPI antibody

PAab05283 100 ug
EUR 355

Anti-MPI antibody

STJ29458 100 µl
EUR 277
Description: Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants.

MPI Conjugated Monoclonal Antibody

C27091 100ul
EUR 397

Mouse MPI shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MPI shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF000862 96 Tests
EUR 689

Human MPI shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MPI protein (His tag)

80R-1951 100 ug
EUR 322
Description: Recombinant human MPI protein

MPI Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MPI Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MPI Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MPI Recombinant Protein (Human)

RP019768 100 ug Ask for price

MPI Recombinant Protein (Human)

RP019771 100 ug Ask for price

MPI Recombinant Protein (Rat)

RP212141 100 ug Ask for price


PVT16860 2 ug
EUR 325

MPI Recombinant Protein (Mouse)

RP151253 100 ug Ask for price

Mannose Phosphate Isomerase (MPI) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mannose Phosphate Isomerase (MPI) Antibody

abx159618-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody

abx146036-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody

abx029275-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody

abx029275-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Mannose Phosphate Isomerase (MPI) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody

abx235283-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mannose Phosphate Isomerase (MPI) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human MPI Antibody (Biotin Conjugate)

32207-05121 150 ug
EUR 369

MPI ORF Vector (Human) (pORF)

ORF006590 1.0 ug DNA
EUR 95

MPI ORF Vector (Human) (pORF)

ORF006591 1.0 ug DNA
EUR 95

Anti-MPI Antibody (monoclonal, 11I4)

M00175 100ug/vial
EUR 294

Mpi ORF Vector (Mouse) (pORF)

ORF050419 1.0 ug DNA
EUR 506

Mpi ORF Vector (Rat) (pORF)

ORF070715 1.0 ug DNA
EUR 506

Recombinant Mannose Phosphate Isomerase (MPI)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P34949
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 50.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Mannose Phosphate Isomerase expressed in: E.coli

MPI ELISA Kit (Human) (OKCD00121)

OKCD00121 96 Wells
EUR 831
Description: Description of target: Involved in the synthesis of the GDP-mannose and dolichol-phosphate-mannose required for a number of critical mannosyl transfer reactions. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.7 pg/mL

MPI ELISA Kit (Human) (OKAN06131)

OKAN06131 96 Wells
EUR 792
Description: Description of target: Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

MPI ELISA Kit (Human) (OKDD00401)

OKDD00401 96 Wells
EUR 975
Description: Description of target: Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.061 ng/mL

Polyclonal MPI Antibody - C-terminal region

APR08502G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MPI - C-terminal region. This antibody is tested and proven to work in the following applications:

Human Mannose Phosphate Isomerase (MPI) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mannose Phosphate Isomerase (MPI) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Mannose Phosphate Isomerase/MPI Antibody

A00175 100ug/vial
EUR 334

Human MPI AssayLite Antibody (FITC Conjugate)

32207-05141 150 ug
EUR 428

Human MPI AssayLite Antibody (RPE Conjugate)

32207-05151 150 ug
EUR 428

Human MPI AssayLite Antibody (APC Conjugate)

32207-05161 150 ug
EUR 428

Human MPI AssayLite Antibody (PerCP Conjugate)

32207-05171 150 ug
EUR 471

MPI sgRNA CRISPR Lentivector set (Human)

K1320501 3 x 1.0 ug
EUR 339

Mpi sgRNA CRISPR Lentivector set (Mouse)

K4472201 3 x 1.0 ug
EUR 339

Human Mannose-6-phosphate isomerase (MPI)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 73.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Mannose-6-phosphate isomerase(MPI) expressed in E.coli

Mpi sgRNA CRISPR Lentivector set (Rat)

K7188601 3 x 1.0 ug
EUR 339

Human Mannose Phosphate Isomerase (MPI) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Mannose Phosphate Isomerase (MPI) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

MPI sgRNA CRISPR Lentivector (Human) (Target 1)

K1320502 1.0 ug DNA
EUR 154