MPI

Human Mannose Phosphate Isomerase (MPI) ELISA Kit
DLR-MPI-Hu-96T	DL Develop	96T	EUR 673
Should the Human Mannose Phosphate Isomerase (MPI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mannose Phosphate Isomerase (MPI) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Mannose Phosphate Isomerase (MPI) ELISA Kit
RD-MPI-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Mannose Phosphate Isomerase (MPI) ELISA Kit
RD-MPI-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Mannose Phosphate Isomerase (MPI) ELISA Kit
RDR-MPI-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Mannose Phosphate Isomerase (MPI) ELISA Kit
RDR-MPI-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mpi/ Rat Mpi ELISA Kit
ELI-23457r	Lifescience Market	96 Tests	EUR 886

MPI siRNA
20-abx903311	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MPI-5a
B2833-1000	Biovision		EUR 251

MPI-5a
B2833-500	Biovision		EUR 164

MPI-0479605
B3706-1	ApexBio	1 mg	EUR 112
Description: MPI-0479605 is a small-molecule inhibitor of the Mitotic Kinase Mps1 with IC50 value of 1.8nM [1].MPI-0479605 is a selective and ATP competitive inhibitor of Mps1.

MPI-0479605
B3706-10	ApexBio	10 mg	EUR 551
Description: MPI-0479605 is a small-molecule inhibitor of the Mitotic Kinase Mps1 with IC50 value of 1.8nM [1].MPI-0479605 is a selective and ATP competitive inhibitor of Mps1.

MPI-0479605
B3706-25	ApexBio	25 mg	EUR 1146
Description: MPI-0479605 is a small-molecule inhibitor of the Mitotic Kinase Mps1 with IC50 value of 1.8nM [1].MPI-0479605 is a selective and ATP competitive inhibitor of Mps1.

MPI-0479605
B3706-5	ApexBio	5 mg	EUR 315
Description: MPI-0479605 is a small-molecule inhibitor of the Mitotic Kinase Mps1 with IC50 value of 1.8nM [1].MPI-0479605 is a selective and ATP competitive inhibitor of Mps1.

MPI-0441138
C3296-10	ApexBio	10 mg	EUR 373
Description: EC50: 2 nM for caspase activationMPI-0441138 is an inducer of apoptosis and growth inhibition.Apoptosis or programmed cell death is a process that organisms use to eliminate excessive cells and to control cell numbers.

MPI-0441138
C3296-25	ApexBio	25 mg	EUR 757
Description: EC50: 2 nM for caspase activationMPI-0441138 is an inducer of apoptosis and growth inhibition.Apoptosis or programmed cell death is a process that organisms use to eliminate excessive cells and to control cell numbers.

MPI-0441138
C3296-5	ApexBio	5 mg	EUR 232
Description: EC50: 2 nM for caspase activationMPI-0441138 is an inducer of apoptosis and growth inhibition.Apoptosis or programmed cell death is a process that organisms use to eliminate excessive cells and to control cell numbers.

MPI-0479605
HY-12660	MedChemExpress	5mg	EUR 340

MPI siRNA
20-abx924454	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MPI siRNA
20-abx924455	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MPI-0479605
9589-25	Biovision		EUR 588

MPI-0479605
9589-5	Biovision		EUR 185

MPI antibody
10R-10801	Fitzgerald	100 ug	EUR 381
Description: Mouse monoclonal MPI antibody

MPI antibody
22051-100ul	SAB	100ul	EUR 390

MPI antibody
22328-100ul	SAB	100ul	EUR 390

MPI antibody
70R-18576	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MPI antibody

MPI antibody
70R-12742	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal MPI antibody

MPI antibody
70R-13607	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal MPI antibody

MPI Antibody
1-CSB-PA014754ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MPI Antibody
1-CSB-PA014754GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MPI Antibody
1-CSB-PA014754LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

pENTR223-MPI
PVT12692	Lifescience Market	2 ug	EUR 391

MPI cloning plasmid
CSB-CL014754HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1089 Sequence: atggccgctccgcgagtattcccactttcctgtgcggtgcagcagtatgcctgggggaagatgggttccaacagcgaagtggcgcggctgttggccagcagtgatccactggcccagatcgcagaggacaagccttatgcagagttgtggatggggactcacccccgaggggatg Show more
Description: A cloning plasmid for the MPI gene.

MPI cloning plasmid
CSB-CL014754HU2-10ug	Cusabio	10ug	EUR 465
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1272 Sequence: atggccgctccgcgagtattcccactttcctgtgcggtgcagcagtatgcctgggggaagatgggttccaacagcgaagtggcgcggctgttggccagcagtgatccactggcccagatcgcagaggacaagccttatgcagagttgtggatggggactcacccccgaggggatg Show more
Description: A cloning plasmid for the MPI gene.

anti- MPI antibody
FNab05283	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:100 Immunogen: mannose phosphate isomerase Uniprot ID: P34949 Gene ID: 4351 Research Area: Metabolism
Description: Antibody raised against MPI

MPI Rabbit pAb
A7319-100ul	Abclonal	100 ul	EUR 308

MPI Rabbit pAb
A7319-200ul	Abclonal	200 ul	EUR 459

MPI Rabbit pAb
A7319-20ul	Abclonal	20 ul	EUR 183

MPI Rabbit pAb
A7319-50ul	Abclonal	50 ul	EUR 223

Human MPI Antibody
32207-05111	AssayPro	150 ug	EUR 261

MPI Monoclonal Antibody
27091-100ul	SAB	100ul	EUR 252

MPI Monoclonal Antibody
27091-50ul	SAB	50ul	EUR 187

Anti-MPI antibody
PAab05283	Lifescience Market	100 ug	EUR 355

Anti-MPI antibody
STJ29458	St John's Laboratory	100 µl	EUR 277
Description: Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants.

MPI Conjugated Monoclonal Antibody
C27091	SAB	100ul	EUR 397

Mouse MPI shRNA Plasmid
20-abx980049	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat MPI shRNA Plasmid
20-abx989072	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MPI ELISA KIT|Human
EF000862	Lifescience Market	96 Tests	EUR 689

Human MPI shRNA Plasmid
20-abx952954	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MPI protein (His tag)
80R-1951	Fitzgerald	100 ug	EUR 322
Description: Recombinant human MPI protein

MPI Antibody, HRP conjugated
1-CSB-PA014754LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MPI Antibody, FITC conjugated
1-CSB-PA014754LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MPI Antibody, Biotin conjugated
1-CSB-PA014754LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MPI. Recognizes MPI from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MPI Recombinant Protein (Human)
RP019768	ABM	100 ug	Ask for price

MPI Recombinant Protein (Human)
RP019771	ABM	100 ug	Ask for price

MPI Recombinant Protein (Rat)
RP212141	ABM	100 ug	Ask for price

pCMV-SPORT6-MPI Plasmid
PVT16860	Lifescience Market	2 ug	EUR 325

MPI Recombinant Protein (Mouse)
RP151253	ABM	100 ug	Ask for price

Mannose Phosphate Isomerase (MPI) Antibody
20-abx113595	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody
20-abx128333	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mannose Phosphate Isomerase (MPI) Antibody
abx159618-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody
abx146036-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody
20-abx007189	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody
abx029275-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody
abx029275-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody
20-abx173455	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Mannose Phosphate Isomerase (MPI) Antibody
20-abx322397	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody
abx235283-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Mannose Phosphate Isomerase (MPI) Antibody
20-abx300990	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human MPI Antibody (Biotin Conjugate)
32207-05121	AssayPro	150 ug	EUR 369

MPI ORF Vector (Human) (pORF)
ORF006590	ABM	1.0 ug DNA	EUR 95

MPI ORF Vector (Human) (pORF)
ORF006591	ABM	1.0 ug DNA	EUR 95

Anti-MPI Antibody (monoclonal, 11I4)
M00175	BosterBio	100ug/vial	EUR 294

Mpi ORF Vector (Mouse) (pORF)
ORF050419	ABM	1.0 ug DNA	EUR 506

Mpi ORF Vector (Rat) (pORF)
ORF070715	ABM	1.0 ug DNA	EUR 506

Recombinant Mannose Phosphate Isomerase (MPI)
4-RPH620Hu01	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P34949 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 50.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Mannose Phosphate Isomerase expressed in: E.coli

MPI ELISA Kit (Human) (OKCD00121)
OKCD00121	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Involved in the synthesis of the GDP-mannose and dolichol-phosphate-mannose required for a number of critical mannosyl transfer reactions. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.7 pg/mL

MPI ELISA Kit (Human) (OKAN06131)
OKAN06131	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.7 pg/mL

MPI ELISA Kit (Human) (OKDD00401)
OKDD00401	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Phosphomannose isomerase catalyzes the interconversion of fructose-6-phosphate and mannose-6-phosphate and plays a critical role in maintaining the supply of D-mannose derivatives, which are required for most glycosylation reactions. Mutations in the MPI gene were found in patients with carbohydrate-deficient glycoprotein syndrome, type Ib. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.061 ng/mL

Polyclonal MPI Antibody - C-terminal region
APR08502G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MPI - C-terminal region. This antibody is tested and proven to work in the following applications:

Human Mannose Phosphate Isomerase (MPI) Protein
20-abx166949	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mannose Phosphate Isomerase (MPI) Antibody (HRP)
20-abx314236	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody (FITC)
20-abx314237	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mannose Phosphate Isomerase (MPI) Antibody (Biotin)
20-abx314238	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Mannose Phosphate Isomerase/MPI Antibody
A00175	BosterBio	100ug/vial	EUR 334

Human MPI AssayLite Antibody (FITC Conjugate)
32207-05141	AssayPro	150 ug	EUR 428

Human MPI AssayLite Antibody (RPE Conjugate)
32207-05151	AssayPro	150 ug	EUR 428

Human MPI AssayLite Antibody (APC Conjugate)
32207-05161	AssayPro	150 ug	EUR 428

Human MPI AssayLite Antibody (PerCP Conjugate)
32207-05171	AssayPro	150 ug	EUR 471

MPI sgRNA CRISPR Lentivector set (Human)
K1320501	ABM	3 x 1.0 ug	EUR 339

Mpi sgRNA CRISPR Lentivector set (Mouse)
K4472201	ABM	3 x 1.0 ug	EUR 339

Human Mannose-6-phosphate isomerase (MPI)
1-CSB-EP014754HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 73.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Mannose-6-phosphate isomerase(MPI) expressed in E.coli

Mpi sgRNA CRISPR Lentivector set (Rat)
K7188601	ABM	3 x 1.0 ug	EUR 339

Human Mannose Phosphate Isomerase (MPI) ELISA Kit
20-abx152372	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Mannose Phosphate Isomerase (MPI) CLIA Kit
20-abx495495	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

MPI sgRNA CRISPR Lentivector (Human) (Target 1)
K1320502	ABM	1.0 ug DNA	EUR 154