  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAT8B Polyclonal Antibody

30852-100ul 100ul
EUR 252

NAT8B Polyclonal Antibody

30852-50ul 50ul
EUR 187

NAT8B Polyclonal Antibody

27999-100ul 100ul
EUR 252

NAT8B Polyclonal Antibody

27999-50ul 50ul
EUR 187

NAT8B Rabbit pAb

A13428-100ul 100 ul
EUR 308

NAT8B Rabbit pAb

A13428-200ul 200 ul
EUR 459

NAT8B Rabbit pAb

A13428-20ul 20 ul
EUR 183

NAT8B Rabbit pAb

A13428-50ul 50 ul
EUR 223

NAT8B Blocking Peptide

33R-8328 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NAT8B antibody, catalog no. 70R-6933

NAT8B cloning plasmid

CSB-CL883394HU-10ug 10ug
EUR 230
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 432
  • Sequence: atggccgaacacgccccagccaccttccggcgattactgaagctgcctcgaaccctcatactcttacttgggggggcccttgccctactcctggtctctggctcctggattctggccctcgtgttcagcctcagcctccttcctgccctgtggttccttgccaaaaaaccctggac
  • Show more
Description: A cloning plasmid for the NAT8B gene.

NAT8B Rabbit pAb

A7203-100ul 100 ul
EUR 308

NAT8B Rabbit pAb

A7203-200ul 200 ul
EUR 459

NAT8B Rabbit pAb

A7203-20ul 20 ul
EUR 183

NAT8B Rabbit pAb

A7203-50ul 50 ul
EUR 223

Anti-NAT8B antibody

STJ115389 100 µl
EUR 277

Anti-NAT8B antibody

STJ29283 100 µl
EUR 277

NAT8B Polyclonal Conjugated Antibody

C27999 100ul
EUR 397

NAT8B Polyclonal Conjugated Antibody

C30852 100ul
EUR 397

Human NAT8B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NAT8B Recombinant Protein (Human)

RP020746 100 ug Ask for price

NAT8B Recombinant Protein (Rat)

RP213326 100 ug Ask for price

Polyclonal NAT8B antibody - middle region

APR00808G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAT8B - middle region. This antibody is tested and proven to work in the following applications:

Nat8b ORF Vector (Rat) (pORF)

ORF071110 1.0 ug DNA
EUR 506

NAT8B ORF Vector (Human) (pORF)

ORF006916 1.0 ug DNA
EUR 95

Putative N-Acetyltransferase 8B (NAT8B) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nat8b sgRNA CRISPR Lentivector set (Rat)

K7031301 3 x 1.0 ug
EUR 339

NAT8B sgRNA CRISPR Lentivector set (Human)

K1392601 3 x 1.0 ug
EUR 339

Nat8b sgRNA CRISPR Lentivector (Rat) (Target 1)

K7031302 1.0 ug DNA
EUR 154

Nat8b sgRNA CRISPR Lentivector (Rat) (Target 2)

K7031303 1.0 ug DNA
EUR 154

Nat8b sgRNA CRISPR Lentivector (Rat) (Target 3)

K7031304 1.0 ug DNA
EUR 154

NAT8B sgRNA CRISPR Lentivector (Human) (Target 1)

K1392602 1.0 ug DNA
EUR 154

NAT8B sgRNA CRISPR Lentivector (Human) (Target 2)

K1392603 1.0 ug DNA
EUR 154

NAT8B sgRNA CRISPR Lentivector (Human) (Target 3)

K1392604 1.0 ug DNA
EUR 154

NAT8B Protein Vector (Rat) (pPB-C-His)

PV284438 500 ng
EUR 603

NAT8B Protein Vector (Rat) (pPB-N-His)

PV284439 500 ng
EUR 603

NAT8B Protein Vector (Rat) (pPM-C-HA)

PV284440 500 ng
EUR 603

NAT8B Protein Vector (Rat) (pPM-C-His)

PV284441 500 ng
EUR 603

NAT8B Protein Vector (Human) (pPB-C-His)

PV027661 500 ng
EUR 329

NAT8B Protein Vector (Human) (pPB-N-His)

PV027662 500 ng
EUR 329

NAT8B Protein Vector (Human) (pPM-C-HA)

PV027663 500 ng
EUR 329

NAT8B Protein Vector (Human) (pPM-C-His)

PV027664 500 ng
EUR 329

Nat8b 3'UTR Luciferase Stable Cell Line

TU213761 1.0 ml Ask for price

Nat8b 3'UTR GFP Stable Cell Line

TU263761 1.0 ml Ask for price

NAT8B 3'UTR GFP Stable Cell Line

TU065243 1.0 ml
EUR 2333

NAT8B 3'UTR Luciferase Stable Cell Line

TU015243 1.0 ml
EUR 2333

Human Probable N- acetyltransferase 8B, NAT8B ELISA KIT

ELI-13198h 96 Tests
EUR 824

NAT8B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV666451 1.0 ug DNA
EUR 514

NAT8B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV666455 1.0 ug DNA
EUR 514

NAT8B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV666456 1.0 ug DNA
EUR 514

ELISA kit for Human Probable N-acetyltransferase 8B (NAT8B)

KTE61363-48T 48T
EUR 332
  • Probable N-acetyltransferase 8B encoded by NAT8B is highly similar to the N-acetyltransferase 8 (NAT8) gene product, which is a kidney and liver protein with homology to bacterial acetyltransferases involved in drug resistance. NAT8B is localized on
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Probable N-acetyltransferase 8B (NAT8B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Probable N-acetyltransferase 8B (NAT8B)

KTE61363-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Probable N-acetyltransferase 8B encoded by NAT8B is highly similar to the N-acetyltransferase 8 (NAT8) gene product, which is a kidney and liver protein with homology to bacterial acetyltransferases involved in drug resistance. NAT8B is localized on
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Probable N-acetyltransferase 8B (NAT8B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Probable N-acetyltransferase 8B (NAT8B)

KTE61363-96T 96T
EUR 539
  • Probable N-acetyltransferase 8B encoded by NAT8B is highly similar to the N-acetyltransferase 8 (NAT8) gene product, which is a kidney and liver protein with homology to bacterial acetyltransferases involved in drug resistance. NAT8B is localized on
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Probable N-acetyltransferase 8B (NAT8B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Nat8b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7031305 3 x 1.0 ug
EUR 376

NAT8B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1392605 3 x 1.0 ug
EUR 376

NAT8B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV666452 1.0 ug DNA
EUR 514

NAT8B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV666453 1.0 ug DNA
EUR 572

NAT8B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV666454 1.0 ug DNA
EUR 572

Nat8b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7031306 1.0 ug DNA
EUR 167

Nat8b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7031307 1.0 ug DNA
EUR 167

Nat8b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7031308 1.0 ug DNA
EUR 167

NAT8B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1392606 1.0 ug DNA
EUR 167

NAT8B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1392607 1.0 ug DNA
EUR 167

NAT8B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1392608 1.0 ug DNA
EUR 167