NAT8B

NAT8B siRNA
20-abx925436	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NAT8B Polyclonal Antibody
30852-100ul	SAB	100ul	EUR 252

NAT8B Polyclonal Antibody
30852-50ul	SAB	50ul	EUR 187

NAT8B Polyclonal Antibody
27999-100ul	SAB	100ul	EUR 252

NAT8B Polyclonal Antibody
27999-50ul	SAB	50ul	EUR 187

NAT8B Rabbit pAb
A13428-100ul	Abclonal	100 ul	EUR 308

NAT8B Rabbit pAb
A13428-200ul	Abclonal	200 ul	EUR 459

NAT8B Rabbit pAb
A13428-20ul	Abclonal	20 ul	EUR 183

NAT8B Rabbit pAb
A13428-50ul	Abclonal	50 ul	EUR 223

NAT8B Blocking Peptide
33R-8328	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NAT8B antibody, catalog no. 70R-6933

NAT8B cloning plasmid
CSB-CL883394HU-10ug	Cusabio	10ug	EUR 230
Formulation: 10 μg plasmid + 200μl Glycerol Length: 432 Sequence: atggccgaacacgccccagccaccttccggcgattactgaagctgcctcgaaccctcatactcttacttgggggggcccttgccctactcctggtctctggctcctggattctggccctcgtgttcagcctcagcctccttcctgccctgtggttccttgccaaaaaaccctggac Show more
Description: A cloning plasmid for the NAT8B gene.

NAT8B Rabbit pAb
A7203-100ul	Abclonal	100 ul	EUR 308

NAT8B Rabbit pAb
A7203-200ul	Abclonal	200 ul	EUR 459

NAT8B Rabbit pAb
A7203-20ul	Abclonal	20 ul	EUR 183

NAT8B Rabbit pAb
A7203-50ul	Abclonal	50 ul	EUR 223

Anti-NAT8B antibody
STJ115389	St John's Laboratory	100 µl	EUR 277

Anti-NAT8B antibody
STJ29283	St John's Laboratory	100 µl	EUR 277

NAT8B Polyclonal Conjugated Antibody
C27999	SAB	100ul	EUR 397

NAT8B Polyclonal Conjugated Antibody
C30852	SAB	100ul	EUR 397

Human NAT8B shRNA Plasmid
20-abx959780	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NAT8B Recombinant Protein (Human)
RP020746	ABM	100 ug	Ask for price

NAT8B Recombinant Protein (Rat)
RP213326	ABM	100 ug	Ask for price

Polyclonal NAT8B antibody - middle region
APR00808G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAT8B - middle region. This antibody is tested and proven to work in the following applications:

Nat8b ORF Vector (Rat) (pORF)
ORF071110	ABM	1.0 ug DNA	EUR 506

NAT8B ORF Vector (Human) (pORF)
ORF006916	ABM	1.0 ug DNA	EUR 95

Putative N-Acetyltransferase 8B (NAT8B) Antibody
20-abx005437	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Nat8b sgRNA CRISPR Lentivector set (Rat)
K7031301	ABM	3 x 1.0 ug	EUR 339

NAT8B sgRNA CRISPR Lentivector set (Human)
K1392601	ABM	3 x 1.0 ug	EUR 339

Nat8b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7031302	ABM	1.0 ug DNA	EUR 154

Nat8b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7031303	ABM	1.0 ug DNA	EUR 154

Nat8b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7031304	ABM	1.0 ug DNA	EUR 154

NAT8B sgRNA CRISPR Lentivector (Human) (Target 1)
K1392602	ABM	1.0 ug DNA	EUR 154

NAT8B sgRNA CRISPR Lentivector (Human) (Target 2)
K1392603	ABM	1.0 ug DNA	EUR 154

NAT8B sgRNA CRISPR Lentivector (Human) (Target 3)
K1392604	ABM	1.0 ug DNA	EUR 154

NAT8B Protein Vector (Rat) (pPB-C-His)
PV284438	ABM	500 ng	EUR 603

NAT8B Protein Vector (Rat) (pPB-N-His)
PV284439	ABM	500 ng	EUR 603

NAT8B Protein Vector (Rat) (pPM-C-HA)
PV284440	ABM	500 ng	EUR 603

NAT8B Protein Vector (Rat) (pPM-C-His)
PV284441	ABM	500 ng	EUR 603

NAT8B Protein Vector (Human) (pPB-C-His)
PV027661	ABM	500 ng	EUR 329

NAT8B Protein Vector (Human) (pPB-N-His)
PV027662	ABM	500 ng	EUR 329

NAT8B Protein Vector (Human) (pPM-C-HA)
PV027663	ABM	500 ng	EUR 329

NAT8B Protein Vector (Human) (pPM-C-His)
PV027664	ABM	500 ng	EUR 329

Nat8b 3'UTR Luciferase Stable Cell Line
TU213761	ABM	1.0 ml	Ask for price

Nat8b 3'UTR GFP Stable Cell Line
TU263761	ABM	1.0 ml	Ask for price

NAT8B 3'UTR GFP Stable Cell Line
TU065243	ABM	1.0 ml	EUR 2333

NAT8B 3'UTR Luciferase Stable Cell Line
TU015243	ABM	1.0 ml	EUR 2333

Human Probable N- acetyltransferase 8B, NAT8B ELISA KIT
ELI-13198h	Lifescience Market	96 Tests	EUR 824

NAT8B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV666451	ABM	1.0 ug DNA	EUR 514

NAT8B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV666455	ABM	1.0 ug DNA	EUR 514

NAT8B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV666456	ABM	1.0 ug DNA	EUR 514

ELISA kit for Human Probable N-acetyltransferase 8B (NAT8B)
KTE61363-48T	Abbkine	48T	EUR 332
Probable N-acetyltransferase 8B encoded by NAT8B is highly similar to the N-acetyltransferase 8 (NAT8) gene product, which is a kidney and liver protein with homology to bacterial acetyltransferases involved in drug resistance. NAT8B is localized on Show more
Description: Quantitative sandwich ELISA for measuring Human Probable N-acetyltransferase 8B (NAT8B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Probable N-acetyltransferase 8B (NAT8B)
KTE61363-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Probable N-acetyltransferase 8B encoded by NAT8B is highly similar to the N-acetyltransferase 8 (NAT8) gene product, which is a kidney and liver protein with homology to bacterial acetyltransferases involved in drug resistance. NAT8B is localized on Show more
Description: Quantitative sandwich ELISA for measuring Human Probable N-acetyltransferase 8B (NAT8B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Probable N-acetyltransferase 8B (NAT8B)
KTE61363-96T	Abbkine	96T	EUR 539
Probable N-acetyltransferase 8B encoded by NAT8B is highly similar to the N-acetyltransferase 8 (NAT8) gene product, which is a kidney and liver protein with homology to bacterial acetyltransferases involved in drug resistance. NAT8B is localized on Show more
Description: Quantitative sandwich ELISA for measuring Human Probable N-acetyltransferase 8B (NAT8B) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Nat8b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7031305	ABM	3 x 1.0 ug	EUR 376

NAT8B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1392605	ABM	3 x 1.0 ug	EUR 376

NAT8B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV666452	ABM	1.0 ug DNA	EUR 514

NAT8B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV666453	ABM	1.0 ug DNA	EUR 572

NAT8B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV666454	ABM	1.0 ug DNA	EUR 572

Nat8b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7031306	ABM	1.0 ug DNA	EUR 167

Nat8b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7031307	ABM	1.0 ug DNA	EUR 167

Nat8b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7031308	ABM	1.0 ug DNA	EUR 167

NAT8B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1392606	ABM	1.0 ug DNA	EUR 167

NAT8B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1392607	ABM	1.0 ug DNA	EUR 167

NAT8B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1392608	ABM	1.0 ug DNA	EUR 167