TRAPPC10 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TRAPPC10. Recognizes TRAPPC10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA27382 50 ug
EUR 363
Description: Mouse polyclonal to TRAPPC10
TRAPPC10 Conjugated Antibody
C39173 100ul
EUR 397
TRAPPC10 cloning plasmid
CSB-CL024226HU-10ug 10ug
EUR 342
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 831
  • Sequence: atggacgcctctgaggagccgctgccgccggtgatctacaccatggagaacaagcccatcgtcacctgtgctggagatcagaatttatttacctctgtttatccaacgctctctcagcagcttccaagagaaccaatggaatggagaaggtcctatggccgggctccgaagatgat
  • Show more
Description: A cloning plasmid for the TRAPPC10 gene.
TRAPPC10 Rabbit pAb
A6777-100ul 100 ul
EUR 308
TRAPPC10 Rabbit pAb
A6777-200ul 200 ul
EUR 459
TRAPPC10 Rabbit pAb
A6777-20ul 20 ul
EUR 183
TRAPPC10 Rabbit pAb
A6777-50ul 50 ul
EUR 223
Anti-TRAPPC10 antibody
STJ28860 100 µl
EUR 277
Description: The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1.
ELI-28448h 96 Tests
EUR 824
Mouse Trappc10 ELISA KIT
ELI-28865m 96 Tests
EUR 865
Human TRAPPC10 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Trappc10 ORF Vector (Rat) (pORF)
ORF078183 1.0 ug DNA
EUR 506
TRAPPC10 ORF Vector (Human) (pORF)
ORF010934 1.0 ug DNA
EUR 95
Trappc10 ORF Vector (Mouse) (pORF)
ORF060303 1.0 ug DNA
EUR 506
Trappc10 sgRNA CRISPR Lentivector set (Rat)
K6353701 3 x 1.0 ug
EUR 339
Trappc10 sgRNA CRISPR Lentivector set (Mouse)
K3327601 3 x 1.0 ug
EUR 339
TRAPPC10 sgRNA CRISPR Lentivector set (Human)
K2442101 3 x 1.0 ug
EUR 339
Trappc10 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6353702 1.0 ug DNA
EUR 154
Trappc10 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6353703 1.0 ug DNA
EUR 154
Trappc10 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6353704 1.0 ug DNA
EUR 154
Trappc10 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3327602 1.0 ug DNA
EUR 154
Trappc10 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3327603 1.0 ug DNA
EUR 154
Trappc10 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3327604 1.0 ug DNA
EUR 154
TRAPPC10 sgRNA CRISPR Lentivector (Human) (Target 1)
K2442102 1.0 ug DNA
EUR 154
TRAPPC10 sgRNA CRISPR Lentivector (Human) (Target 2)
K2442103 1.0 ug DNA
EUR 154
TRAPPC10 sgRNA CRISPR Lentivector (Human) (Target 3)
K2442104 1.0 ug DNA
EUR 154
TRAPPC10 Protein Vector (Rat) (pPB-C-His)
PV312730 500 ng
EUR 1191
TRAPPC10 Protein Vector (Rat) (pPB-N-His)
PV312731 500 ng
EUR 1191
TRAPPC10 Protein Vector (Rat) (pPM-C-HA)
PV312732 500 ng
EUR 1191
TRAPPC10 Protein Vector (Rat) (pPM-C-His)
PV312733 500 ng
EUR 1191
TRAPPC10 Protein Vector (Mouse) (pPB-C-His)
PV241210 500 ng
EUR 1065
TRAPPC10 Protein Vector (Mouse) (pPB-N-His)
PV241211 500 ng
EUR 1065
TRAPPC10 Protein Vector (Mouse) (pPM-C-HA)
PV241212 500 ng
EUR 1065
TRAPPC10 Protein Vector (Mouse) (pPM-C-His)
PV241213 500 ng
EUR 1065
TRAPPC10 Protein Vector (Human) (pPB-C-His)
PV043733 500 ng
EUR 329
TRAPPC10 Protein Vector (Human) (pPB-N-His)
PV043734 500 ng
EUR 329
TRAPPC10 Protein Vector (Human) (pPM-C-HA)
PV043735 500 ng
EUR 329
TRAPPC10 Protein Vector (Human) (pPM-C-His)
PV043736 500 ng
EUR 329
Trappc10 3'UTR Luciferase Stable Cell Line
TU121038 1.0 ml Ask for price
Trappc10 3'UTR GFP Stable Cell Line
TU171038 1.0 ml Ask for price
Trappc10 3'UTR Luciferase Stable Cell Line
TU222390 1.0 ml Ask for price
TRAPPC10 3'UTR GFP Stable Cell Line
TU076306 1.0 ml
EUR 2333
TRAPPC10 3'UTR Luciferase Stable Cell Line
TU026306 1.0 ml
EUR 2333
Trappc10 3'UTR GFP Stable Cell Line
TU272390 1.0 ml Ask for price
Trafficking Protein Particle Complex Subunit 10 (TRAPPC10) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex Subunit 10 (TRAPPC10) Antibody
abx145337-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex Subunit 10 (TRAPPC10) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6353705 3 x 1.0 ug
EUR 376
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3327605 3 x 1.0 ug
EUR 376
TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2442105 3 x 1.0 ug
EUR 376
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6353706 1.0 ug DNA
EUR 167
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6353707 1.0 ug DNA
EUR 167
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6353708 1.0 ug DNA
EUR 167
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3327606 1.0 ug DNA
EUR 167
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3327607 1.0 ug DNA
EUR 167
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3327608 1.0 ug DNA
EUR 167
TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2442106 1.0 ug DNA
EUR 167
TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2442107 1.0 ug DNA
EUR 167
TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2442108 1.0 ug DNA
EUR 167