TRAPPC10

TRAPPC10 antibody
39173-100ul 100ul
EUR 252.00
TRAPPC10 siRNA
20-abx937939
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TRAPPC10
YF-PA27382 50 ug
EUR 363.00
Description: Mouse polyclonal to TRAPPC10
TRAPPC10 Conjugated Antibody
C39173 100ul
EUR 397.00
TRAPPC10 cloning plasmid
CSB-CL024226HU-10ug 10ug
EUR 342.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 831
  • Sequence: atggacgcctctgaggagccgctgccgccggtgatctacaccatggagaacaagcccatcgtcacctgtgctggagatcagaatttatttacctctgtttatccaacgctctctcagcagcttccaagagaaccaatggaatggagaaggtcctatggccgggctccgaagatgat
  • Show more
Description: A cloning plasmid for the TRAPPC10 gene.
TRAPPC10 Rabbit pAb
A6777-100ul 100 ul
EUR 308.00
TRAPPC10 Rabbit pAb
A6777-200ul 200 ul
EUR 459.00
TRAPPC10 Rabbit pAb
A6777-20ul 20 ul
EUR 183.00
TRAPPC10 Rabbit pAb
A6777-50ul 50 ul
EUR 223.00
Anti-TRAPPC10 antibody
STJ28860 100 µl
EUR 277.00
Description: The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1.
Human TRAPPC10 shRNA Plasmid
20-abx954876
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Trappc10 ELISA KIT
ELI-28865m 96 Tests
EUR 865.00
Human TRAPPC10 ELISA KIT
ELI-28448h 96 Tests
EUR 824.00
TRAPPC10 ORF Vector (Human) (pORF)
ORF010934 1.0 ug DNA
EUR 95.00
Trappc10 ORF Vector (Mouse) (pORF)
ORF060303 1.0 ug DNA
EUR 506.00
Trappc10 ORF Vector (Rat) (pORF)
ORF078183 1.0 ug DNA
EUR 506.00
TRAPPC10 sgRNA CRISPR Lentivector set (Human)
K2442101 3 x 1.0 ug
EUR 339.00
Trappc10 sgRNA CRISPR Lentivector set (Mouse)
K3327601 3 x 1.0 ug
EUR 339.00
Trappc10 sgRNA CRISPR Lentivector set (Rat)
K6353701 3 x 1.0 ug
EUR 339.00
TRAPPC10 sgRNA CRISPR Lentivector (Human) (Target 1)
K2442102 1.0 ug DNA
EUR 154.00
TRAPPC10 sgRNA CRISPR Lentivector (Human) (Target 2)
K2442103 1.0 ug DNA
EUR 154.00
TRAPPC10 sgRNA CRISPR Lentivector (Human) (Target 3)
K2442104 1.0 ug DNA
EUR 154.00
Trappc10 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3327602 1.0 ug DNA
EUR 154.00
Trappc10 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3327603 1.0 ug DNA
EUR 154.00
Trappc10 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3327604 1.0 ug DNA
EUR 154.00
Trappc10 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6353702 1.0 ug DNA
EUR 154.00
Trappc10 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6353703 1.0 ug DNA
EUR 154.00
Trappc10 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6353704 1.0 ug DNA
EUR 154.00
TRAPPC10 Protein Vector (Rat) (pPB-C-His)
PV312730 500 ng
EUR 1191.00
TRAPPC10 Protein Vector (Rat) (pPB-N-His)
PV312731 500 ng
EUR 1191.00
TRAPPC10 Protein Vector (Rat) (pPM-C-HA)
PV312732 500 ng
EUR 1191.00
TRAPPC10 Protein Vector (Rat) (pPM-C-His)
PV312733 500 ng
EUR 1191.00
TRAPPC10 Protein Vector (Mouse) (pPB-C-His)
PV241210 500 ng
EUR 1065.00
TRAPPC10 Protein Vector (Mouse) (pPB-N-His)
PV241211 500 ng
EUR 1065.00
TRAPPC10 Protein Vector (Mouse) (pPM-C-HA)
PV241212 500 ng
EUR 1065.00
TRAPPC10 Protein Vector (Mouse) (pPM-C-His)
PV241213 500 ng
EUR 1065.00
TRAPPC10 Protein Vector (Human) (pPB-C-His)
PV043733 500 ng
EUR 329.00
TRAPPC10 Protein Vector (Human) (pPB-N-His)
PV043734 500 ng
EUR 329.00
TRAPPC10 Protein Vector (Human) (pPM-C-HA)
PV043735 500 ng
EUR 329.00
TRAPPC10 Protein Vector (Human) (pPM-C-His)
PV043736 500 ng
EUR 329.00
Trappc10 3'UTR Luciferase Stable Cell Line
TU121038 1.0 ml Ask for price
TRAPPC10 3'UTR Luciferase Stable Cell Line
TU026306 1.0 ml
EUR 2333.00
Trappc10 3'UTR GFP Stable Cell Line
TU171038 1.0 ml Ask for price
TRAPPC10 3'UTR GFP Stable Cell Line
TU076306 1.0 ml
EUR 2333.00
Trappc10 3'UTR Luciferase Stable Cell Line
TU222390 1.0 ml Ask for price
Trappc10 3'UTR GFP Stable Cell Line
TU272390 1.0 ml Ask for price
Trafficking Protein Particle Complex Subunit 10 (TRAPPC10) Antibody
20-abx005199
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex Subunit 10 (TRAPPC10) Antibody
abx145337-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex Subunit 10 (TRAPPC10) Antibody
20-abx320724
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2442105 3 x 1.0 ug
EUR 376.00
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3327605 3 x 1.0 ug
EUR 376.00
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6353705 3 x 1.0 ug
EUR 376.00
TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2442106 1.0 ug DNA
EUR 167.00
TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2442107 1.0 ug DNA
EUR 167.00
TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2442108 1.0 ug DNA
EUR 167.00
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3327606 1.0 ug DNA
EUR 167.00
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3327607 1.0 ug DNA
EUR 167.00
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3327608 1.0 ug DNA
EUR 167.00
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6353706 1.0 ug DNA
EUR 167.00
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6353707 1.0 ug DNA
EUR 167.00
Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6353708 1.0 ug DNA
EUR 167.00