TRAPPC10

TRAPPC10 antibody
39173-100ul	SAB	100ul	EUR 252

TRAPPC10 Antibody
1-CSB-PA024226ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TRAPPC10. Recognizes TRAPPC10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-TRAPPC10
YF-PA27382	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TRAPPC10

TRAPPC10 Conjugated Antibody
C39173	SAB	100ul	EUR 397

TRAPPC10 cloning plasmid
CSB-CL024226HU-10ug	Cusabio	10ug	EUR 342
Formulation: 10 μg plasmid + 200μl Glycerol Length: 831 Sequence: atggacgcctctgaggagccgctgccgccggtgatctacaccatggagaacaagcccatcgtcacctgtgctggagatcagaatttatttacctctgtttatccaacgctctctcagcagcttccaagagaaccaatggaatggagaaggtcctatggccgggctccgaagatgat Show more
Description: A cloning plasmid for the TRAPPC10 gene.

TRAPPC10 Rabbit pAb
A6777-100ul	Abclonal	100 ul	EUR 308

TRAPPC10 Rabbit pAb
A6777-200ul	Abclonal	200 ul	EUR 459

TRAPPC10 Rabbit pAb
A6777-20ul	Abclonal	20 ul	EUR 183

TRAPPC10 Rabbit pAb
A6777-50ul	Abclonal	50 ul	EUR 223

Anti-TRAPPC10 antibody
STJ28860	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1.

Human TRAPPC10 ELISA KIT
ELI-28448h	Lifescience Market	96 Tests	EUR 824

Mouse Trappc10 ELISA KIT
ELI-28865m	Lifescience Market	96 Tests	EUR 865

Human TRAPPC10 shRNA Plasmid
20-abx954876	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Trappc10 ORF Vector (Rat) (pORF)
ORF078183	ABM	1.0 ug DNA	EUR 506

TRAPPC10 ORF Vector (Human) (pORF)
ORF010934	ABM	1.0 ug DNA	EUR 95

Trappc10 ORF Vector (Mouse) (pORF)
ORF060303	ABM	1.0 ug DNA	EUR 506

TRAPPC10 sgRNA CRISPR Lentivector set (Human)
K2442101	ABM	3 x 1.0 ug	EUR 339

Trappc10 sgRNA CRISPR Lentivector set (Rat)
K6353701	ABM	3 x 1.0 ug	EUR 339

Trappc10 sgRNA CRISPR Lentivector set (Mouse)
K3327601	ABM	3 x 1.0 ug	EUR 339

TRAPPC10 sgRNA CRISPR Lentivector (Human) (Target 1)
K2442102	ABM	1.0 ug DNA	EUR 154

TRAPPC10 sgRNA CRISPR Lentivector (Human) (Target 2)
K2442103	ABM	1.0 ug DNA	EUR 154

TRAPPC10 sgRNA CRISPR Lentivector (Human) (Target 3)
K2442104	ABM	1.0 ug DNA	EUR 154

Trappc10 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6353702	ABM	1.0 ug DNA	EUR 154

Trappc10 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6353703	ABM	1.0 ug DNA	EUR 154

Trappc10 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6353704	ABM	1.0 ug DNA	EUR 154

Trappc10 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3327602	ABM	1.0 ug DNA	EUR 154

Trappc10 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3327603	ABM	1.0 ug DNA	EUR 154

Trappc10 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3327604	ABM	1.0 ug DNA	EUR 154

TRAPPC10 Protein Vector (Human) (pPB-C-His)
PV043733	ABM	500 ng	EUR 329

TRAPPC10 Protein Vector (Human) (pPB-N-His)
PV043734	ABM	500 ng	EUR 329

TRAPPC10 Protein Vector (Human) (pPM-C-HA)
PV043735	ABM	500 ng	EUR 329

TRAPPC10 Protein Vector (Human) (pPM-C-His)
PV043736	ABM	500 ng	EUR 329

TRAPPC10 Protein Vector (Rat) (pPB-C-His)
PV312730	ABM	500 ng	EUR 1191

TRAPPC10 Protein Vector (Rat) (pPB-N-His)
PV312731	ABM	500 ng	EUR 1191

TRAPPC10 Protein Vector (Rat) (pPM-C-HA)
PV312732	ABM	500 ng	EUR 1191

TRAPPC10 Protein Vector (Rat) (pPM-C-His)
PV312733	ABM	500 ng	EUR 1191

TRAPPC10 Protein Vector (Mouse) (pPB-C-His)
PV241210	ABM	500 ng	EUR 1065

TRAPPC10 Protein Vector (Mouse) (pPB-N-His)
PV241211	ABM	500 ng	EUR 1065

TRAPPC10 Protein Vector (Mouse) (pPM-C-HA)
PV241212	ABM	500 ng	EUR 1065

TRAPPC10 Protein Vector (Mouse) (pPM-C-His)
PV241213	ABM	500 ng	EUR 1065

Trappc10 3'UTR GFP Stable Cell Line
TU171038	ABM	1.0 ml	Ask for price

TRAPPC10 3'UTR GFP Stable Cell Line
TU076306	ABM	1.0 ml	EUR 2333

Trappc10 3'UTR Luciferase Stable Cell Line
TU121038	ABM	1.0 ml	Ask for price

TRAPPC10 3'UTR Luciferase Stable Cell Line
TU026306	ABM	1.0 ml	EUR 2333

Trappc10 3'UTR Luciferase Stable Cell Line
TU222390	ABM	1.0 ml	Ask for price

Trappc10 3'UTR GFP Stable Cell Line
TU272390	ABM	1.0 ml	Ask for price

Trafficking Protein Particle Complex Subunit 10 (TRAPPC10) Antibody
abx145337-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Trafficking Protein Particle Complex Subunit 10 (TRAPPC10) Antibody
20-abx005199	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Trafficking Protein Particle Complex Subunit 10 (TRAPPC10) Antibody
20-abx320724	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2442105	ABM	3 x 1.0 ug	EUR 376

Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6353705	ABM	3 x 1.0 ug	EUR 376

Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3327605	ABM	3 x 1.0 ug	EUR 376

TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2442106	ABM	1.0 ug DNA	EUR 167

TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2442107	ABM	1.0 ug DNA	EUR 167

TRAPPC10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2442108	ABM	1.0 ug DNA	EUR 167

Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6353706	ABM	1.0 ug DNA	EUR 167

Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6353707	ABM	1.0 ug DNA	EUR 167

Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6353708	ABM	1.0 ug DNA	EUR 167

Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3327606	ABM	1.0 ug DNA	EUR 167

Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3327607	ABM	1.0 ug DNA	EUR 167

Trappc10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3327608	ABM	1.0 ug DNA	EUR 167